Isolation, Characterization and Phylogenetic Analysis of Nodule-Associated Bacteria from Mimosa Pudica L.


Maya Ravunni and Akkara Yusuf *

Interuniversity Centre for Plant Biotechnology, Department of Botany, University of Calicut, Malappuram, Kerala, India.

Corresponding Author E-mail: akkara69@yahoo.co.in

DOI : http://dx.doi.org/10.13005/bbra/3017

Download this article as:  PDF

ABSTRACT:

The interaction between rhizobia and other nodule-associated bacteria assists to mitigate nutrient stress in leguminous plants by fixing atmospheric nitrogen and synthesizing plant growth regulators. The beneficial effects of microbial inoculants emphasize the need for further research and their use in modern agriculture. The present study describes the isolation, molecular identification, characterization, and phylogenetic analysis of nodule-associated bacteria from Mimosa pudica Linnaeus. Isolation and phenotypic characterization of nodule-associated bacteria were carried out according to standard procedures. Molecular characterization of the isolates was performed using 16S ribosomal RNA. Plant growth promoting the ability of selected isolates was analyzed by assessing indole acetic acid production, nitrogen-fixing ability and organic acid production. Evolutionary distance and relatedness were analyzed using the neighbor-joining method. Thirteen nodule-associated bacteria were isolated and identified using 16S rRNA gene sequencing.  The selected isolates such as Rhizobium sp. CU8 and three other co-resident non-rhizobial nodule-associated bacteria (Bacillus cereus MY5, Ralstonia pickettii MY1 and Lactococcus lactis MY3) exhibited plant growth promotion and other potential microbial activities. Phylogenetic analysis revealed the genetic relatedness and evolutionary significance of all the thirteen isolates reside in the root nodule of M. pudica. The present study identified four isolates with plant growth promoting properties. L. lactis MY3 is the first report as a co-resident plant growth promoter from the root nodules of M. pudica.

KEYWORDS:

Nitrogen fixers; Phylogenetic analysis; Plant growth promoters; Root nodule; 16S rRNA

Introduction

The members of Leguminosae, are associated with endophytic, root nodule-associated bacteria (NAB) which ameliorates nutrient stress by fixing atmospheric nitrogen (N2) and producing plant growth promoters. The genus Mimosa received considerable attention in recent years because of its potential to fix atmospheric nitrogen. Biological nitrogen fixation is ecologically important, contributing ~100-290 million tons of nitrogen annually to the natural ecosystem and enhancing the growth of agronomically important forage and crop plants. Biological nitrogen fixation (both symbiotic fixers and non-symbiotic fixers) reduces the use of synthetic nitrogen fertilizers.

Plant growth promoting bacteria (PGPB) enhance plant growth by fixing atmospheric nitrogen and its assimilation to the plant, production of siderophores to chelate iron and its absorption, solubilization of minerals such as phosphorus, synthesis of phytohormones, augmenting plant nutrient uptake1, 2and the production of substances like antibiotics1. In addition, the PGP microbes express abiotic stress tolerance like extreme temperature, drought, salinity, pH, heavy metal and pesticide pollution 3.

 PGPB has beneficial effects on legume growth and some strains enhance the nodulation and nitrogen fixation by effective interaction between plant and rhizobia4. Most of the nodulating bacteria are free-living rhizobacteria, however, some are intracellular or intercellular endophytes5 and gain advantage of being protected from environmental stresses and microbial competition 6. The endophytes and epiphytes are the two different types of plant growth promoting rhizobia associated with host tissue. There are many endophytic and epiphytic bacteria which are directly or indirectly involved in plant growth and development. Endophytic bacteria live in plant tissues without affecting the normal metabolism of the host or gaining any benefit other than a noncompetitive environment inside the host. It has been demonstrated that bacterial endophytes play a beneficial role in host plants, such as growth promotion and biological control of pathogens 7, 8, 9. Legume root nodules may contain microbes other than rhizobia 10, 11, however, the function of these co-residents in the nodules is yet to be fully elucidated, and their main role might be to assist rhizobia during the nodule infection process and to promote plant growth 12, 13.

Modern agriculture faces challenges, such as loss of soil fertility, fluctuating climatic factors, and increasing pathogen and pest attacks. The sustainability and environmental safety of agricultural production rely on eco-friendly approaches like the use of biofertilizers, biopesticides, and crop residue recycling. Increasing the food quality and quantity, without affecting sustainable plant productivity, and maintaining environmental quality is the principal aspect from the Agricultural and Ecological standpoint. The importance of nitrogen-fixing and plant growth promoting bacteria and their gene conservation can contribute better to sustain agriculture and 16S ribosomal RNA typing is used to identify microorganisms. The 16S rRNA based phylogenetic analysis revealed the relatedness of genus Rhizobium, Bacillus, Ralstonia, Burkholderia, cupriavidus and Lactococcus isolated from the root nodule of M. pudica. Our understanding of microbial interactions in the rhizosphere must be complemented by combining the basic and applied studies.

The beneficial effects of microbial inoculants, particularly nitrogen-fixing and plant growth promoters (PGP), from the root nodule of M. pudica accentuate the need for research and its application in modern agriculture. The present study is focused on the isolation, identification, characterization and comprehensive evaluation of phylogenetic relationship based on 16S rRNA gene of potential nitrogen fixers and plant growth promoters from root nodule of M. pudica.

Materials and methods

Isolation of nodule-associated bacteria

Bacterial isolates were obtained from the root nodules of M. pudica grown in different locations in the University of Calicut campus (11°08’01.0″N, 75°53’19.0″E; 11°08’00.4″N, 75°53’17.5″E). The nodule-associated bacteria (NAB), were isolated from healthy pink coloured root nodules, washed thoroughly using running tap water, surface sterilized using 70% (v/v) ethanol for 30s, 0.1% (w/v) HgCl2 for 2 min and washed thrice with sterile double distilled water under aseptic condition for one min 14. Nodules were crushed using a sterile glass rod and the extracts were plated onto Yeast Mannitol agar medium pH 6.8, supplemented with Congo red dye (0.025 gl-1). The cultures were incubated at 28±2ºC for 24-48hrs. Single colony-forming units were checked for purity by repeated transferring on to nutrient agar medium having pH-7 15. Pure cultures were maintained on a nutrient agar medium with regular subculturing and used for analysis.

Phenotypic characterization

Phenotypic characterization based on the morphological and biochemical characters were done on bacterial isolates grown in nutrient agar medium using Bergey’s manual of systematic bacteriology 16. The morphological characters were listed using gram staining, motility test by hanging drop method and endospore staining by malachite green method using a phase contrast microscope. Biochemical analysis was performed using indole production, hydrolysis of urea, methyl red (MR) test, voges proskauer (VP), citrate utilization and nitrate reduction test. The intrinsic antibiotic resistance of the isolates was determined by the disc method with Ampicillin (Amp) (10 mcg/disc), Tetracycline (TE) (30 mcg/disc), and Penicillin G (PG) (10 IU/disc) 17.

Molecular characterization

DNA extraction, 16S ribosomal RNA typing and sequencing

Bacterial genomic DNA was extracted and purified using CTAB method 18. The purified DNA was quantified using a Nanodrop 2000 spectrometer (UV scanning Thermo scientific). PCR amplification of the 16S rRNA gene was carried out using the universal primers 1-27F (AGAGTTTGATCCTGGCTCAG) and 1495R (CTACGGCTACCTGTTACGA) 19. Amplification was performed in thermocycler with following PCR conditions: 30 cycles of 94 ⁰C for 45 s, 50 ⁰C for 1 min, and 72 ⁰C for 1.30 min with initial denaturation at 94 ⁰C for 3 min and final extension at 72 ⁰C for 10 min. The band size was verified using agarose gel electrophoresis. The PCR products were cleaned and sequenced from Agrigenome Lab Pvt Ltd, Cochin, Kerala. Cloned 16S rRNA sequences were minimally edited and manually aligned using Bioedit software. Species identification and homology of the sequences were identified using BLAST (https://www.ncbi.nlm.nih.gov/BLAST/). The cloned 16S rRNA sequences were submitted to GenBank, NCBI and accession numbers were obtained.

Characterization of plant growth promoting potential of bacterial isolates

The plant growth enhancement potential of the four isolates was verified using their potential to produce indole acetic acid, organic acid and capacity to fix atmospheric nitrogen in plants.

Production of indole acetic acid (IAA)

IAA production capacity of the isolates was identified using bacterial cultures grown in nutrient broth supplemented with 0.1% L-Tryptophan (w/v) incubated at 30⁰C for 48hrs. Indole acetic acid (IAA) production was analysed using the colorimetric method of Gordon and Weber 20. IAA in the culture was quantified using a standard calibration curve prepared using gradient concentrations of IAA.

Production of organic acid

Assessed by growing bacterial culture in calcium carbonate agar [CaCO3 5 gl-1, glucose 50 gl-1, yeast extract 5 gl-1, agar 15 gl-1] medium and the clear zone around the colony confirmed the production of organic acid.

Assessment of nitrogen fixation

The N2 fixation capacity was evaluated by growing the cultures in nitrogen-free malate containing bromothymol blue medium [DL- Malic acid 5 gl-1, KOH 4 gl-1, K2HPO4 0.5 gl-1, FeSO4.7H2O 0.05 gl-1, MnSO4.7H2O 0.01 gl-1, MgSO4 0.01 gl-1, NaCl 0.02 gl-1, CaCl2 0.01 gl-1, Na2MoO4 0.002 gl-1, Yeast extract 0.05 gl-1, Bromothymol Blue 2  mLl-1 ] for 24-48 hrs at 30ºC kept on a rotary shaker at 120 rpm 21. The change in colour of the medium from pale green to pale blue indicates the ability to fix atmospheric N2.

16S rRNA-based phylogenetic analysis

Phylogenetic analysis based on the16S rRNA sequence was performed using MEGA 7.0 program22 based on neighbor-joining statistical method 23 and the branching support of 1000 bootstrap 24. The phylogenetic tree construction based on 16S rRNA sequences from nodule-associated bacteria isolated from M. pudica was aligned using ClustalW. The model selection was performed using MEGA 7 22 based on the lowest Bayesian Information Criterion (BIC) value 25.

Statistical analysis

Using the SPSS software (27.0V, SPSS, Chicago, USA), one-way ANOVA was performed to analyze the concentration of IAA in the isolates after 48hrs. Statistical analysis was carried out according to Tukey’s test (P≤0.05). The data were an average of 4 separate experimental observations with three independent replicates (n=3).

Results and discussion

Isolation of root nodule associated bacteria

A total of 13 root nodule-associated bacteria were isolated from M. pudica. All the isolates were purified and subcultured on nutrient agar medium (pH-7). The isolated pure bacterial strains were characterized using morphological, biochemical and molecular techniques.

The nodule surface sterilization was aimed to allow the obtention of nodule-associated bacteria 26 resulting in the isolation of thirteen nodule-associated bacteria from the root nodule of M. pudica. Out of the 13 NAB obtained, nine were non-rhizobial nodule associated bacteria. According to the results of Rajendran14 about 10% of the surface sterilized nodules showed the presence of endophytic non-rhizobial flora and some nodules showed more than one morphologically distinct non-rhizobial colonies. In the past, bacteria isolated from the nodules with different growth and appearance to that of typical rhizobia were considered contaminants and discarded, however, recent studies convincingly demonstrated the occurrence of non-rhizobial bacteria in the nodules and their role on the host plants, rhizobial strains or the symbiosis are under investigation 10. It is now well recognized that non-rhizobial bacteria can promote plant growth by an array of mechanisms including solubilization and mobilization of nutrients 27, N2-fixation 28, production of phytohormones 29, along with microbial processes. Nodule endophytes belonging to the genera Bacillus, Burkholderia, Pseudomonas and Enterobacter have been isolated from different legumes 10, 30.

Molecular characterization

DNA extraction, 16S ribosomal RNA typing and sequencing

Genomic DNA from the thirteen isolates was extracted using CTAB method. The 260/280 ratio of the DNA samples was 1.8-2 indicating the purity of the samples. Molecular characterization and homology search using the 16S rRNA sequences confirmed that the thirteen isolates are strain CU8, strain MY5, strain MY1, strain MY3, strain MNMY3, strain MY6, strain CU3, strain CU2, strain MY2, strain CUMY1, strain MYB1, strain MYB5 and strain CUMY2 which shows higher similarity to Rhizobium sp., Bacillus cereus, Ralstonia pickettii, Lactococcus lactis, Cupriavidus sp., Burkholderia sp., Bacillus sp., Bacillus sp., Bacillus sp., Bacillus thuringiensis, Bacillus cereus, Bacillus sp. and Bacillus cereus  respectively. The 16S rRNA gene from the strain Rhizobium sp. CU8, B. cereus MY5, R. pickettii MY1, L. lactis MY3, B. cereus CUMY2, B. cereus MYB1, Bacillus sp. MYB5, Bacillus sp. MY2, Bacillus sp. CU2, Bacillus sp. CU3, B. thuringensis CUMY1, Burkholderia sp. MY6 and Cupriavidus sp. MNMY3 were possessed 99-100% homology with the nucleotide sequence of other species available in NCBI. L. lactis MY3 from the root nodules of M. pudica is not reported earlier. GenBank accession numbers provided for the 16S rRNA gene sequence of thirteen nodule-associated bacteria are given in Table 1.

Table 1: Accession numbers of 16S rRNA sequences obtained from the M. pudica nodule associated bacteria.

Isolated strain sequences deposited in GenBank

Closest match among bacteria  (16S rRNA) (GenBank)

Strain

Length (bp)

Accession number

Species

Accession number

Percentage of identity

MY3

1487

MW132401

Lactococcus lactis

MW429822

99.58%

MNMY3

1388

MT039465

Cupriavidus sp.

MG798711

99.93%

CU8

1347

MN744368

Rhizobium sp.

MT415399

99.85%

MY6

1428

MN744356

Burkholderia sp.

KP744003

98.87%

CU3

1489

MN744346

Bacillus sp.

MZ004949

90.32%

CU2

1500

MN744342

Bacillus sp.

MT102910

90.62%

MY2

1406

MK002738

Bacillus sp.

AB646981

100%

CUMYI

1406

MK002737

Bacillus thuringiensis

KX977387

99.93%

MYB1

1401

MK002734

Bacillus cereus

MT611946

100%

MY1

1397

MH997486

Ralstonia pickettii

MT341804

99.93%

MYB5

1407

MH997484

Bacillus sp.

MK847260

99.93%

MY5

1344

MH997483

Bacillus cereus

DQ289077

99.18%

CUMY2

1407

MH997482

Bacillus cereus

MK253249

99.93%

Rhizobia are a functional class of soil bacteria having a nitrogen-fixing symbiosis with legumes, also termed legume nodulating bacteria (or LNB). The ability to nodulate legumes is spread among the alpha and beta- subclasses of Proteobacteria. Beta-rhizobia was originally described in 2001 in two parallel studies: the first study identified Burkholderia tuberum and B. phymatum from Aspalathus carnosa and Machaerium lunatum plant respectively which were belongs to the family Papilionoideae and the second study isolated R. taiwanensis from two Mimosa species which was later named as Cupriavidus taiwanensis 31. Verma 32 has demonstrated the widespread occurrence of beta rhizobia as symbionts in Indian Mimosa species.

It has previously been documented that many non-rhizobial endophytes are often associated with root nodules of a variety of legumes 30, 15, 10 and the genetic diversity of these endophytes is often high 13,10. Among these, Bacillus and Pseudomonas are particularly common 13, 10 and these genera are well-recognized for their roles in plant growth promotion and biocontrol over soilborne pathogens 34. These two genera are also prominent among rhizoplane bacteria of a variety of plants. Thus, the high diversity of root nodule-associated bacteria in Mimosa and the predominance of Bacillus and Pseudomonas was not unexpected inside the M. pudica nodule, as seen in previous studies 4.

Phenotypic characterization

Phenotypic characteristics such as shape, gram’s reaction, motility and spore formation and biochemical characterization like indole production, hydrolysis of urea, MR-VP, citrate utilization, nitrate reduction and antibiotic sensitivity are presented in supplementary Table 1. All the twelve isolates except L. lactis MY3 were rod-shaped and motile and L. lactis MY3 are spherical and non-motile. Rhizobium sp.CU8, Cupriavidus sp. MNMY3, Burkholderia sp. MY6 and Ralstonia pickettii MY1 were gram negative and Bacillus cereus MY5, Bacillus cereus CUMY2, Bacillus cereus MYB1, Bacillus sp. MYB5, Bacillus sp. MY2, Bacillus sp. CU2, Bacillus sp. CU3, Bacillus thuringensis CUMY1, and L. lactis MY3 were gram-positive reactions. Except for Rhizobium sp.CU8, Cupriavidus sp. MNMY3, Burkholderia sp. MY6 and R. pickettii MY1 all the isolates showed sporulation.  In MR-VP biochemical characteristics, except L. lactis MY3 all the isolates were negative in MR test and except Cupriavidus sp. MNMY3, Burkholderia sp. MY6 and L. lactis MY3 showed a positive response to VP test. Nitrate reduction Cupriavidus sp. MNMY3, Rhizobium sp. CU8, B. cereus MY5 and B. thuringensis CUMY1 were positive to nitrate reduction and all other isolates were negative. In urease characteristics, all the cultures showed positive urease test. The isolates Bacillus sp. CU3,    B. cereus MYB1 and   Bacillus sp. MYB5 showed delayed positive urease activity. Rhizobium sp. CU8, B. cereus MY5 and R. pickettii MY1 were positive to indole and others were negative. Except B. cereus CUMY2 were negative to citrate utilization. Of the thirteen bacterial isolates tested for antibiotic such as tetracycline (30 µg/disc), penicillin-G (10 IU/disc), ampicillin(10 mcg/disc) and erythromycin (15 µg/disc) showed atleast sensitive to one antibiotic.

There were many reports on the diversity of microorganisms in the rhizosphere, the present study revealed nodule bacterial diversity exists even among the organisms associated with the nodules. According to Rajendran 14 probably all the organisms whose presence has a beneficial relation might get associated with the root nodules. The isolated NAB showed 80% similarity in the biochemical features examined. The morphological and microscopic features of the isolates were in congruence with the earlier reports of the species. In agriculture, the use of PGPB as inoculants is widely applied but only limited studies addressed their antibiotic resistance. Thus, the best practice is to do that systematically, to limit antibiotic resistance gene (ARG) distribution into the environment 35 and also the use of high quality, effective rhizobia on agriculture have contributed significantly to the economy of farming systems through the biological nitrogen fixation in the rhizosphere. However, the rhizosphere comprises large populations of antibiotic-producing microorganisms, which affect susceptible rhizobia36. Thus, antibiotic resistance is an extremely valuable and positive selection marker to select symbiotically effective bacteria. Our findings show that all the isolates were sensitive to at least one standard antibiotics and can be used as a safe biofertilizer candidate.

Characterization of plant growth promoting activities

IAA production potential of the isolates

IAA production during the 48hr of growth was quantified in Rhizobium sp. CU8, B. cereus MY5, R. pickettii MY1 and L. lactis MY3 using Salkowski reagent. R. pickettii MY1 and Rhizobium sp. CU8 developed colour immediately after the addition of reagents indicating the formation of IAA and better IAA production was observed when the cultures were incubated for 25 min in dark. The highest quantity of IAA was produced in R. pickettii MY1 (49.8630±0.1779 µg/ml) followed by B. cereus MY5 (13.5159±0.2416 µg/ml), Rhizobium sp. CU8 (11.6895±0.1837 µg/ml) and L. lactis MY3 (4.9315 ±0.0790 µg/ml) (Fig. 1) after 48hrs of incubation, which was significant at P<0.05.

A diverse group of microbes, including free-living, epiphytic and tissue colonizing bacteria synthesizes IAA 37. The four strains produced a considerable quantity of IAA, which is comparable with earlier studies on various bacteria including Rhizobium sp., B. cereus, R. pickettii and L. lactis 38, 39, 40, 41. According to Datta and Basu 42, most of the studies reported that IAA-producing organisms are gram-negative, however, few Bacillus are known to produce IAA which is gram-positive strains 43. The present study showed that B. cereus MY5 is IAA-producing gram-positive bacteria.    

Figure 1: The quantity of IAA produced in different bacterial spp. isolated during 48 hrs of culture. The different letters indicates the significantly difference at the P0<0.05 level. Values are given as mean±SE for each sample

Click here to view figure

Production of organic acid

Among the four isolates, L. lactis MY3 showed a clear zone after 24hrs of incubation due to the degradation of calcium carbonate leading to the production of organic acid. The other three isolates don’t show any clear zone around the colony.

L. lactis is a rare observation from the root nodule of M. pudica and can be used as an agent for plant growth promotion44. L. lactis develop organic acid indicating the interactions between PGPR and plants can enhance the secretion of organic acids, which play an important role in the process of the activation and absorption of insoluble nutrients by plants 45.

Nitrogen fixing potential of the isolates

The four isolates, Rhizobium sp. CU8, B. cereus MY5, R. pickettii MY1 and L. lactis MY3 exhibited N2 fixing ability grown in nitrogen-free malate medium containing bromothymol blue as an indicator. The Rhizobium sp. CU8, B. cereus MY5 and R. pickettii MY1 showed a significant colour change from pale green to pale blue indicating N2 fixing ability within 24hrs. However, L. lactis MY3 developed the colour change only after 48hrs.

The interaction between rhizobia and other nodule-associated bacteria is of high relevance due to the N2 fixation and other plant growth promotion capacities in leguminous plants 46, 26 Zhao 47 reported endophytic non-rhizobial Bacillus cereus and Ralstonia spp. are potent N2 fixers. The genus Rhizobium is the first bacteria participating in nitrogen fixation in legumes 48. According to Higdon 49, Lactococcal bacteria exist as a diazotroph in maize without nifHDKENB homologs and hypothesized that L. lactis isolates from the mucilage microbiota of Sierra Mixe maize possess genes enabling BNF activity and elucidated that all the important genes for the BNF trait in L. lactis underpinning the ability to fix atmospheric nitrogen present in the mucilage-derived Lactococci, which supports the hypothesis that Lactococci can exist as diazotrophs.

Phylogeny based on 16S rRNA gene

The cloned 16S rRNA sequences were used to construct the phylogenetic tree using neighbor-joining (NJ) method with 1000 bootstraps. Models with the lowest BIC scores were considered to describe the best nucleotide substitution pattern. Bayesian Information Criterion (BIC) and Akaike Information Criterion (AIC) are the best-fit nucleotide-substitution models determined using MEGA 7.0. Models with the lowest BIC scores (Bayesian Information Criterion) are depicted as the best substitution pattern with 16S rRNA sequence of the 13 nodule-associated bacteria isolated from M. pudica provided TN93+I (Tamura 3-parameter model), with the lowest BIC score (11977.858), and lowest AIC score (11755.020).

The TN93+I (Tamura Nei Model) displayed the lowest BIC scores (11977.858- supplementary data 1) to construct a consensus NJ tree from the aligned sequences. In NJ tree, Group I consist of B. cereus MYB1, Bacillus sp. MY2, B. cereus MY5, Bacillus sp. CU2 , Bacillus sp. CU3,  L. lactis MY3, B. cereus CUMY2, B. thuringiensis CUMY1 and Bacillus sp. MYB5 and Group II consist of Cupriavidus sp. MNMY3, Burkholderia sp.  MY6, R.  pickettii MY1 and Rhizobium sp. CU8 (Fig. 2.). The optimal tree with the sum of branch length = 0.3866 is shown in Fig. 2. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) are shown next to the branches. The evolutionary distances were computed using the Tamura-Nei method and are in the units of the number of transitional substitutions per site. The analysis involved 13 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. All ambiguous positions were removed for each sequence pair. There were a total of 1482 positions in the final dataset. In NJ tree, the isolates in the first groups includes in the phylum Firmicutes and the Group II isolates belongs to phylum Proteobacteria. The branching where started from phylum to genus level.

Figure 2: Neighbor joining tree constructed using 16S rRNA gene sequences of 13 nodule associated bacteria isolated from M. pudica. Numbers beneath nodes are Bootstrap support (BS) indices and branch length.

Click here to view figure

The evolutionary history was derived using the neighbor-joining method and maximum Likelihood method based on the Tamura-Nei model50. The bootstrap consensus tree developed from 1000 replicates represented the evolutionary history of the taxa analyzed 24. Branches corresponding to partitions reproduced in less than 50% of bootstrap replicates are collapsed. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches24. The development of the bacterial taxonomy can be traced through earlier reviews by Jordan 51, Graham 52, Young 53, Elkan 54, and Martinez-Romero55,  and the 13 nodule-associated bacterial isolates showed evolutionary relatedness and grouping in congruence with the bacterial taxonomic classification.

Conclusions

This study reports the isolation, molecular identification, characterization and phylogenetic relationship of the thirteen root nodule-associated bacteria of M. pudica. The biochemical analysis confirms the nitrogen-fixing potential, plant growth promotion and other potential microbial activities of the Rhizobium sp. CU8, B. cereus MY5, R. pickettii MY1 and L. lactis MY3. The bacteria with N2 fixing capacity act as plant growth promoters and hence can be used as biofertilizers. L. lactis strain MY3 is a new report from the root nodule of M. pudica with plant growth promotion and N2 fixation capacity. Phylogenetic analysis using neighbor-joining method showed the relatedness and evolutionary position of the isolates. The analysis showed that non-rhizobial bacteria, B. cereus MY5, B. cereus CUMY2, B. cereus MYB1, Bacillus sp. MYB5, Bacillus sp. MY2, Bacillus sp. CU2, Bacillus sp. CU3, B. thuringensis CUMY1, and L. lactis MY3 may co-exist with Rhizobium sp.CU8, Cupriavidus sp. MNMY3, Burkholderia sp. MY6 and R. pickettii MY1 in the root nodule of M. pudica. However, it requires further studies to assess the role of these isolates in N2 fixation and plant growth promotion under pot culture as well as in field condition and these can be used as a potential biofertilizer.

Acknowledgement

The author acknowledge the facilities provided by the Director, Interuniversity Centre for Plant Biotechnology, University of Calicut, for providing facilities

Conflicts of Interest

The authors declare that they have no conflict of interest.

Funding Sources

This work was supported by the University of Calicut, Government of Kerala for the research grants (Grant numbers 11347/2016/Admn).

References

  1. Glick B. R. The enhancement of plant growth by free living bacteria. Can J Microbiol. 1995; 41: 109-117. https://doi.org/10.1139/m95-015
  2. Kloepper J. W. Plant growth-promoting rhizobacteria as biological control agents. Soil microbial ecology: applications in agricultural and environmental management. 1992; 255-274.
  1. Gopalakrishnan S., Sathya A., Vijayabharathi R., Varshney R. K., Gowda C. L., Krishnamurthy L. Plant growth promoting rhizobia: challenges and opportunities. 3 Biotech. 2015; 5(4):355-377. https://doi.org/10.1007/s13205-014-0241-x
  2. Parmar N and Dadarwal K. R. Stimulation of nitrogen fixation and induction of flavonoid-like compounds by rhizobacteria. J Appl Microbiol. 1999; 86: 36-64. https://doi.org/10.1046/j.1365-2672.1999.00634.x
  3. Sturz A.V and Nowak J. Endophytic communities of rhizobacteria and the strategies required to create yield enhancing associations with crops. Soil Ecol. 2000; 15: 183-190. https://doi.org/10.1016/S0929-1393(00)00094-9
  4. Kobayashi D.Y and Palumbo J. D. Bacterial endophytes and their effects on plants and uses in agriculture. In Microbial endophytes,CRC Press. 2000; pp. 213-250. eBook ISBN9780429179334
  5. Downing K. J and Thomson J. A. Introduction of the Serratia marcescens chiA gene into an endophytic Pseudomonas fluorescens for the biocontrol of phytopathogenic fungi. J. Microbiol. 2000; 46: 363-369. https://doi.org/10.1139/w99-147
  6. Ryu C. M., Kim J. W., Choi O. H., Park S. Y., Park S. H., Park C. S. Nature of a root associated Paenibacillus polymyxa from field-grown winter barley in Korea. J Microbiol Biotechnol. 2005; 15: 984-991.
  7. Sturz A. V., Christie B. R., Matheson B. G., Arsenault W. J., Buchanan N. A. Endophytic bacterial communities in the periderm of potato tubers and their potential to improve resistance to soil-borne plant pathogens. Plant Pathol. 1999; 48(3):360-369. https://doi.org/10.1046/j.1365-3059.1999.00351.x
  8. Martinez-Hidalgo P and Hirsch A. M. The nodule microbiome: N2-fixing rhizobia do not live alone. 2017; 1(6): 7082. https://doi.org/10.1094/PBIOMES-12-16-0019-RVW
  9. Zgadzaj R, James E. K., Kelly S., Kawaharada Y., de Jonge N., Jensen D. B., Madsen L. H., Radutoiu S. A legume genetic framework controls infection of nodules by symbiotic and endophytic bacteria. PLoS Genet. 2015; 11(6): e1005280. https://doi.org/10.1371/journal.pgen.10052803
  10. Chibeba A. M., Pereira C. S., Antunes J. E. L., Ribeiro R. A., de Almeida Lopes A. C., Gomes R. L. F., Hungaria M, Araujo A. S. F. Polyphasic characterisation of nitrogen-fixing and co-resident bacteria in nodules of Phaseolus lunatus inoculated with soils from Piauí State, Northeast Brazil. Symbiosis. 2020; 80(3): 279-292. https://doi.org/10.1007/s13199-020-00672-1
  11. Peix A., Ramírez-Bahena M. H., Velázquez E., Bedmar E. J. Bacterial associations with legumes. CRC Crit Rev Plant Sci. 2015; 34(1-3): 17-42. https://doi.org/10.1080/07352689.2014.897899
  12. Rajendran G., Patel M. H., Joshi S. J. Isolation and characterisation of nodule-associated Exiguobacterium from the root nodules of fenugreek (Trigonella foenum-graecum) and their possible role in plant growth promotion. Int J Microbiol. 2012. https://doi.org/10.1155/2012/693982
  13. Vincent J. M. A manual for the practical study of the root-nodule bacteria. Black well scientific publication, Oxford. 1970. https://doi.org/10.1002/jobm.19720120524
  14. Boone D. R., and Castenholz R. W.: Bergey’s manual of systematic bacteriology, Volume 1. New York: Springer.
  15. Cappuccino J. G and Sherman N; Microbiology: A laboratory manual, 10th edn Addision-1999. 1983.
  16. Ausubel F. M., Brent R., Kingston R. E., Moore D. D., Seidman J. G., Smith J. A., Struhl K. (ed): Short Protocols in Molecular Biology, 3rd New Tork: John Wiley and Sons Inc. 1995; pp 2.11- 2.12.99
  17. Lane D. J. 16S/23S rRNA Sequencing. In: Stackebrandt, E. and Good fellow, M., Eds., Nucleic Acid Techniques in Bacterial Systematic, John Wiley and Sons, New York. 1991; pp. 115-175.
  18. Gordon S. A and Weber R. P. Colorimetric estimation of indole acetic acid. Plant physiol. 1951; 26(1): 192. https://dx.doi.org/10.1104%2Fpp.26.1.1klo92
  19. Döbereiner J and Day J. M. Associative symbioses in tropical grasses: characterization of microorganisms and dinitrogen-fixing sites. In Proceedings of the 1st international symposium on nitrogen fixation, Washington State University Press, Pullman. 1976; 2:518-538
  20. Kumar S., Stecher G., Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Biol. Evol. 2016; 33(7):1870-1874. https://doi.org/10.1093/molbev/msw054
  21. Felsenstein J. Evolutionary trees from gene frequencies and quantitative characters: finding maximum likelihood estimates. Evol. 1981: 1229-1242. https://doi.org/10.2307/2408134
  22. Felsenstein J. Confidence limits on phylogenies: An approach using the bootstrap. Evol. 1985; 39: 783-791. https://doi.org/10.1111/j.1558-5646.1985.tb00420.x
  23. Schwarz G. Estimating the dimension of a model. Ann Stat. 1978; 6(2): 461-464. https://doi.org/10.1214/aos/1176344136
  24. Rajendran G., Sing F., Desai A. J., Archana G. Enhanced growth and nodulation of pigeon pea by co-inoculation of Bacillus strains with Rhizobium spp. Bioresour Technol. 2008;  99(11):4544-4550. https://doi.org/10.1016/j.biortech.2007.06.057
  25. Srivastwa P. K., Kanhaiyaji V., Nishi K. Growth promotion of plant by nutrient mobilizing PGPR of salt-affected soil. Asian J Soil Sci. 2014; 9(1):126-129
  26. Castellano-Hinojosa , Correa-Galeote D., Palau J., Bedmar E. J. Isolation of N2-fixing rhizobacteria from Lolium perenne and evaluating their plant growth promoting traits. J Basic Microbiol. 2016; 56(1):85-91. https://doi.org/10.1002/jobm.201500247
  27. Chinnaswamy A., Coba de la Peña T., Stoll A., de la Peña R. D., Bravo J., Rincón A., Lucas M., Pueyo J. A nodule endophytic Bacillus megaterium strain isolated from Medicago polymorpha enhances growth, promotes nodulation by Ensifer medicae and alleviates salt stress in alfalfa plants. Ann Appl Biol. 2018; 172(3):295-308. https://doi.org/10.1111/aab.12420
  28. Dudeja S., Giri R., Saini R., Suneja-Madan P., Kothe E. Interaction of endophytic microbes with legumes. J Basic Microbiol. 2012; 52(3): 248-260. https://doi.org/10.1002/jobm.201100063
  29. Mishra R. P., Tisseyre P., Melkonian , Chaintreuil C., Miche L., Klonowska A., Moulin L. Genetic diversity of Mimosa pudica rhizobial symbionts in soils of French Guiana: investigating the origin and diversity of Burkholderia phymatum and other beta-rhizobia. FEMS microbiology ecology. 2012; 79(2): 487-503.
  30. Verma S. C., Chowdhury S. P., and Tripathi A. K. Phylogeny based on 16S rDNA and nifH sequences of Ralstonia taiwanensis strains isolated from nitrogen-fixing nodules of Mimosa pudica, in India. J. Microbiol. 2004; 50(5):313-322.
  31. De Meyer E., De Beuf K., Vekeman B and Willems A. A large diversity of non-rhizobial endophytes found in legume root nodules in Flanders (Belgium). Soil Biol. Biochem. 2015; 83: 1-11.
  32. Santoyo G., Orozco-Mosqueda M. D. C., Govindappa M. Mechanisms of biocontrol and plant growth-promoting activity in soil bacterial species of Bacillus and Pseudomonas: a review. Biocontrol Sci Technol. 2012; 22(8): 855-872.
  33. Fahsi N., Mahdi I., Mesfioui A., Biskri L., Allaoui A. Plant Growth-Promoting Rhizobacteria isolated from the Jujube (Ziziphus lotus) plant enhance wheat growth, Zn uptake, and heavy metal tolerance. Agriculture. 2021; 11(4): 316. https://doi.org/10.3390/agriculture11040316
  34. Junior M. D. A. L., Lima A. S. T., Arruda, J. R. F., Smith, D. L. Effect of root temperature on nodule development of bean, lentil and pea. Soil Biol.Biochem. 2005; 37(2): 235-239.
  35. Patten C. L and Glick B. R. Bacterial biosynthesis of indole-3-acetic acid. Can J Microbiol. 1996; 42(3): 207-220. https://doi.org/10.1139/m96-032
  36. Kumar P. R and Ram M. R. Production of indole acetic acid by Rhizobium isolates from Vigna trilobata (L) Verdc. Afr J Microbiol Res. 2012; 6(27):5536-5541. https://doi.org/10.5897/AJMR11.105
  37. Kuklinsky‐Sobral J., Araújo W. L., Mendes R., Geraldi I. O., Pizzirani‐Kleiner A. A., Azevedo J. L. Isolation and characterization of soybean‐associated bacteria and their potential for plant growth promotion. Environ Microbiol. 2004; 6(12):1244-1251. https://doi.org/10.1111/j.1462-2920.2004.00658.x
  38. Mohite B. Isolation and characterization of indole acetic acid (IAA) producing bacteria from rhizospheric soil and its effect on plant growth. Soil Sci Plant Nutr. 2013; 13(3):638-649. http://dx.doi.org/10.4067/S0718-95162013005000051
  39. Strafella S., Simpson D. J., Yaghoubi Khanghahi M., De Angelis M., Gänzle M., Minervini F., Crecchio C. Comparative Genomics and In Vitro Plant Growth Promotion and Biocontrol Traits of Lactic Acid Bacteria from the Wheat Rhizosphere. 2021; 9(1):78. https://doi.org/10.3390/microorganisms9010078
  40. Datta C and Basu P. S. Indole acetic acid production by a Rhizobium species from root nodules of a leguminous shrub, Cajanus cajanMicrobiol Res. 2000; 155(2):123-127. https://doi.org/10.1016/S0944-5013(00)80047-6
  41. Wahyudi A. T., Astuti R. P., Widyawati A., Mery A., Nawangsih A. A. Characterization of Bacillus strains isolated from rhizosphere of soybean plants for their use as potential plant growth for promoting rhizobacteria. J Microbiol Antimicrob. 2011; 3(2):34-40. https://doi.org/10.5897/JMA.9000020
  42. Lamont J. R., Wilkins O., Bywater-Ekegärd M., Smith D. L. From yogurt to yield: Potential applications of lactic acid bacteria in plant production. Soil Biol Biochem. 2017; 111:1-9. https://doi.org/10.1016/j.soilbio.2017.03.015
  43. Pii Y., Penn A., Terzano R., Crecchio C., Mimmo T., Cesco S. Plant-microorganism-soil interactions influence the Fe availability in the rhizosphere of cucumber plants. Plant Physiol Biochem. 2015; 87:45-52. https://doi.org/10.1016/j.plaphy.2014.12.014
  44. Barea J. M., Pozo M. J., Azco’n R., Azco´n-Aguilar C. Microbial co-operation in the rhizosphere. J Exp Bot. 2005; 56:1761-1778. https://doi.org/10.1093/jxb/eri197
  45. Zhao L., Xu Y., Sun R., Deng Z., Yang W., Wei G. Identification and characterization of the endophytic plant growth prompter Bacillus cereus strain MQ23 isolated from Sophora alopecuroides root nodules. Braz J Microbiol. 2011;42(2):567-575. https://dx.doi.org/10.1590%2FS1517-838220110002000022
  46. Lindström K and Mousavi S. A. Effectiveness of nitrogen fixation in rhizobia. Microb Biotechnol. 2020; 13(5):1314-1335. https://doi.org/10.1111/1751-7915.13517
  47. Higdon S. M., Pozzo T., Kong N., Huang B. C., Yang L., Jeannotte R., Weimer BC. Genomic characterization of a diazotrophic microbiota associated with maize aerial root mucilage. PLoS one. 2020; 15(9):e0239677. https://doi.org/10.1371/journal.pone.0239677
  48. Tamura K and Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol Biol Evol. 1993; 10:512-526. https://doi.org/10.1093/oxfordjournals.molbev.a040023
  49. Jordan D. C.: Rhizobiaceae. Bergey’s mannual of systematic bacteriology, 1984; 1: 234-256
  50. Graham P. H., Sadowsky M. J., Keyser H. H., Barnet Y. M., Bradley R. S., Cooper J. E., Young   P. W. Proposed minimal standards for the description of new genera and species of root-and stem-nodulating bacteria. International Journal of Systematic and Evolutionary Microbiology. 1991; 41(4): 582-587.
  51. Young J. W. Phylogenetic classification of nitrogen-fixing organisms. Biological nitrogen fixation. 1992; 1544:43-86.
  52. Elkan G. H. Taxonomy of the rhizobia. J. Microbiol. 1992; 38(6): 446-450.
  53. Martínez-Romero E.: Recent developments in Rhizobium taxonomy. In Symbiotic Nitrogen Fixation. Springer, Dordrecht.  1994; pp. 11-20.
Visited 1,849 times, 1 visit(s) today
Article Metrics
PlumX PlumX: 
Views Views:  696 Views
PDF Downloads PDF Downloads:  1518

Article Publishing History
Received on: 10-04-2022
Accepted on: 17-09-2022

Article Review Details
Reviewed by: Dr. Ajar Nath Yadav
Second Review by: Dr. Manita Paneri
Final Approval by: Dr. Eugene A. Silow


Share

FOLLOW US ON:

facebook Twitter Mendeley LinkedIn


SEARCH WEBSITE


MEMBER OF

Logo-image


JOURNAL ARCHIVED IN

Logo-image