Screening of Mutation in Parkin Gene – Exon 3 for Diagnosis of Parkinson’s Disease


R. Thirugnanasambandam1*, A. M. Sabitha Rani2, L. Stanley Abraham1 and Vasantharaja Raguraman1

1Centre for Ocean Research, Sathyabama University, Jeppiaar Nagar, Rajiv Gandhi Road, Chennai – 600119.

2Department of Biotechnology, Prince Shri Venkateshwara Arts and Science College, Gowrivakkam, Chennai –600091.

Download this article as:  PDF

ABSTRACT:

The present study focuses to screen the mutation in parkin gene (exon3) of Parkinson’s diseased patients by collecting blood samples from 16 early onset Parkinson’s disease patients in the age group of below 45 years. To detect these mutations, we performed an effective technique based on the real-time TaqMan PCR system. The amplified product was subjected to sequence analysis for confirming mutation in Parkin gene (exon3). The chromatogram was collected and subjected to sequence alignment using BLAST software. The sequenced exon 3 was visualized for the presence of Mutation. In this study, we have not identified any mutation in exon 3 and conclude that there are possibilities for the involvement of other exons in induction of this disorder to become the basis for a diagnostic test.

KEYWORDS:

Parkinson’s disease; DNA; gene; parkin; exon 3; mutation

Introduction

Parkinson disease (PD) is one among the highest neurodegenerative disease following the Alzheimer, with approximately six million cases have been reported worldwide1. The PD is characterized by neurodegenerative movement disorder, with a syndrome of tremor, muscular rigidity, slowing of physical movement (bradykinesia), and loss of physical movement (akinesia)2.  The present scenario in PD research vividly shows that there is increasing evidence of genetic factors contributing to sporadic PD. The death of dopaminergic neurons in the substantia nigra pars compacta is the major causative phenomenon of PD.

In most patients with Parkinson’s disease, treatment is effective in the early stage of diagnosis, but not all symptoms cure and the expediency of treatment is eventually vulnerable by the emergence of drug-resistant symptoms, drug-induced maladies, or both3. In recent years, there are increasing numbers of genetic disorder found to be associated with familial PD. At present there are more than 18 genes have been identified to be associated with the monogenic types of parkinsonism and related disorders. These specific genes, code for an autosomal recessive (AR) mode of inheritance, such as parkin (PARK2), PINK1 (PARK6), DJ–1 (PARK7), ATP13A2 (PARK9), PLA2G6 (PARK14) and FBXO7 (PARK15), are found in patients with not only familial PD, but also sporadic PD4,5,6,7,8. PARK2 (Parkin) gene mutations were first identified in autosomal recessive juvenile with the onset of Parkinsonism (ARJPD)9. It is located in the chromosomal location 6q25.2-q2710. Mutations in the loci of Parkin gene result in the loss of Parkin function, slow down the destruction of the defective proteins causing them to accumulate in the cell, and lead to the nigral neuronal degeneration11. Parkin is one of the largest human genes comprising of size 1.38 Mbp. It consists of 12 coding exons separated by large intronic regions. The parkin gene translates to about 465-amino acid protein, corresponding to a ubiquitin-like domain at the N terminus and a RING (Really Interesting New Gene) loci possessing three RING finger motifs (RING0, 1, and 2). RING 1 and 2 are separated by a sequence without any recognizable domain structure named IBR (in between-RING)12.

The present study focuses specifically on the screening of mutation in the exon 3 of parkin gene for the early diagnosis of Parkinson’s disease with special reference to young age group below 45 years.

Materials and Methods

The Peripheral blood (3 mL) was collected from clinically diagnosed 16 PD patientsin the age group of below 45 years. Genomic DNA was isolated from patients and controls using standard protocols. The exon 3 of the parkin gene was amplified by PCR using the below mentionedprimer (Table 1). All reaction was performed in 10-µl reaction mixtures, containing 10X PCR buffer, 15 mM Mgcl2, 10 mM DNTPs, 5 pmol of each forward and reverse primer and 0.01 µl of Taq DNA polymerase. The initial denaturation at 95º C for 5 min was followed by 30 cycles of denaturation at 95º C for 40 s, 57º C for 45 s, 72º C for 45 s, and a final extension at 72º C for 5 min. The PCR products were electrophoresed on 2% agarose gel and visualized with ethidium bromide. The PCR amplified exon 3 of parkin gene was purified using the axygen PCR purification kit. Purified PCR product were sequenced an automated sequencer according to the manufactures’ recommendations to detect mutations.

   Table 1: Primer Sequences for RT- PCR

Gene Sequence
PARK2 (exon 3)

 

Forward 5’ AATTGTGACCTGGATCAG 3’

Reverse 5’CTGGACTTCCAGCTGGTGGTGAG 3’

 

Results and Discussion

In the 16 patients analyzed The amplified PCR product of Parkin gene (exon 3) was analyzed for the unknown mutation. The documented gel exhibits band size 241bp (Fig .1).

Figure 1: Documented gel of Parkin gene (exon 3) [L1-L5 Samples; L6-DNA Ladder] Figure 1: Documented gel of Parkin gene (exon 3) [L1-L5 Samples; L6-DNA Ladder]

 

Click here to View figure

The PCR amplicons of Parkin exon 3 was analyzed for the unknown mutation by sequencing the respective amplicons. The mutation was found in the control. The nucleotide sequence was aligned using blast software and chromatogram was collected on the parkin gene sequence (Fig.2).Sequencing confirmed that the RT-PCR products were the parkin gene (Fig.3).

Figure 2: Chromatogram in the parkin gene sequence. Figure 2: Chromatogram in the parkin gene sequence.

 

Click here to View figure

 

Figure 3: Sequencing confirmed that the RT-PCR product was recognized as Parkin.  

Figure 3: Sequencing confirmed that the RT-PCR product was recognized as Parkin.

 

Click here to View figure

In this study, we have analyzed 16 early onset Parkinson’s disease patients for exon 3 mutation. In common, more than 80 % and above mutations were present throughout the parkin gene and we have directly sequenced the exon 3 for the presence of mutation. In this study, we have not identified any mutations in this exon 3. Hence the possibilities of the involvement of the other exons, a complete examination of the whole gene may be followed. We hereby conclude that there are possibilities for the involvement of other exons in induction of this disorder. It is suitable for the analysis of large patient groups, and it may become the basis for a diagnostic test.

Acknowledgement

The authors are thankful to Dr. A. Ramesh, Former HOD, Department of Genetics, and Dr. M. Padmaja Vishwanath, Department of Genetics, Dr. A L M Post Graduate Institute of Basic Medical Sciences, University of Madras, Taramani, Chennai 600 113 for extending the lab facilities and guiding them to carry out the entire work in their lab.

References

  1. Lesage, S., Brice, A. Parkinson’s disease: from monogenic forms to genetic susceptibility factors. Mol. Genet. 2009; 18(R1): R 48–59.
  2. Hedrich, K., Kann, M., Lanthaler, A.J., Dalski, A., Eskelson, C., Landt, O., Schwinger, E., Vieregge, P., Lang, A.E., Breakefield, X.O., Ozelius, L.J., Pramstaller, P.P., Klein,C., The importance of gene dosage studies: mutational analysis of the parkin gene in early-onset parkinsonism. Mol. Genet., 2001; 10: 1649–1656.
  3. Tolosa, E., Marti, M.J., Katzenschlager, K. Pharmacological management of Parkinson’s disease. In: Parkinson’s Disease & Movement Disorders, 6th edn. (Jancovic, J., Tolosa, E., eds.) Philadelphia, PA: Wolters Kluwer, 2015: 86–111.
  4. Guo, J.F., Xiao, B., Liao, B., Zhang, X.W., Nie, L.L., Zhang, Y.H., Shen, L., Jiang, H., Xia, K., Pan, Q., Yan, X.X., Tang, B.S. Mutation analysis of parkin, PINK1, DJ-1 and ATP13A2 genes in Chinese patients with autosomal recessive early-onset Parkinsonism. Disord. 2008; 23: 2074–2079.
  5. Guo, J.F., Zhang, X.W., Nie, L.L., Zhang, H.N., Liao, B., Li, J., Wang, L., Yan, X.X., Tang, B.S. Mutation analysis of parkin, PINK1 and DJ-1 genes in Chinese patients with sporadic early onset parkinsonism. Neurol. 2010; 257: 1170–1175.
  6. Lücking, C.B., Dürr, A., Bonifati, V., Vaughan, J., De Michele, G., Gasser, T., Harhangi, B.S., Meco, G., Denèfle, P., Wood, N.W., Agid, Y., Brice, A. French Parkinson’s disease genetics study group; European consortium on genetic susceptibility in Parkinson’s disease, association between early-onset Parkinson’s disease and mutation in the parkin gene. Engl. J. Med. 2000; 342: 1560–1567.
  7. The Parkinson Disease Mutation Database. http://www.molgen.ua.ac.be/ DmutDB
  8. Tian, J.Y., Tang, B.S., Shi, C.H., Lv, Z.Y., Li, K., Yu, R.L., Shen, L., Yan, X.X., Guo, J.F., Analysis of PLA2G6 gene mutation in sporadic early-onset parkinsonism patients from Chinese population. Lett. 2012; 514: 156–158.
  9. Kitada T., Asakawa, S., Hattori, N., Mutations in the Parkin gene cause autosomal recessive Parkinsonism. Nature. 1998; 392: 605-08.
  10. Matsumine H., Saito, M., Shimoda-Matsubayashi, S. Localization of a gene for an autosomal recessive form of juvenile Parkinsonism to chromosome 6q25.2-27. J. Hum. genet. 1997; 60: 588-96.
  11. Bonifati, V., Rizzu, P., Van Baren, M.J., Schapp, O., Breedveld, G. J., Krieger, E., Dekker, C.J., Squiteri, F., Ibanez, P., Jouse, M., Van Dongen, J. W., Vanacore, N., Van Swieten, J.C., Brice, A., Meco, G., Van Duijn, C. M., Oostra, B. A., Heutink, P. Mutations in the DJ-1 gene associated with autosomal recessive early-onset Parkinsonism. Science. 2003; 299: 256-259.
  12. Bruggemann, N., Klein, C.: Parkin Type of Early-Onset Parkinson Disease. In: Gene Reviews (Pagon, R.A., Adam, M. P., Ardinger, H.H. eds.). Seattle(WA): University of Washington. 1993-2016.
Visited 1,013 times, 1 visit(s) today
Article Publishing History
Received on: 20 April 2016
Accepted on: 05 June 2016


Share

FOLLOW US ON:

facebook Twitter Mendeley LinkedIn


SEARCH WEBSITE


MEMBER OF

Logo-image


JOURNAL ARCHIVED IN

Logo-image