Extension and Modification of Kanai’s DNA Isolation Method for A Spectrum of Human Specimens Collected by Invasive and Noninvasive Methods Suitable for Genotyping Studies


K. N. Arul Jothi, Irusappan Sivaraj, Suruthi Abirami B, Harishankar M. K and Devi Arikketh*
Department of Genetic Engineering, SRM University, Chennai, India – 603203 Corresponding Author Emailadevipradeep@gmail.com,

DOI : http://dx.doi.org/10.13005/bbra/2135

Download this article as:  PDF

ABSTRACT:

There are a number of conventional methods and kits available for human genomic DNA isolation. These methods however come with limitations such as high cost, time-consuming, hazardous, and complex steps. We propose an extended and modified kanai’s method that can be used for DNA isolation from various human specimens (blood, clot, saliva, urine, and cell lines) and from Gram-negative bacterial samples. The DNA isolated by this method was tested for suitability in genetic analysis techniques such as PCR RFLP, ARMS PCR, and High Resolution Melt analysis. The DNA isolated had high purity (mean A260/A280 = 1.7 to 1.8) and was stable at 4°C and - 20°C. This method is suitable for very low volume of blood (20 µl), long stored blood (3 years), and also for noninvasive samples. The DNA gave consistent and accurate results in PCR RFLP, ARMS, and HRM techniques. We have demonstrated that the DNA isolation method is an effective method for fresh blood, blood clot, saliva, urine and cell line samples and we prove its applicability in genotyping studies.

KEYWORDS:

High Resolution melt analysis; Genetic analysis; ARMS PCR; blood clot

Introduction

Recently, molecular analysis of genomic DNA has become indispensable in genetic diagnostics and forensic analysis. The major sources of genomic DNA include fresh blood, clotted blood, lymphocytes, saliva, and exfoliated cells.1, 2  Of these sample sources, blood and saliva are highly reliable and are most commonly used for genetic studies.3,4,5,6

Each type of sample requires a specific protocol to isolate genomic DNA. At present, there are numerous commercial kits available7,8,9,10 that are specific to each type of specimen, which leads to a multiplicity of kits in the laboratory for DNA isolation purposes. The cost of commercial kits and the multiplicity of kits is a limiting factor11,12 for research in laboratories in certain developing and underdeveloped nations. This work provides a single DNA isolation protocol that can be applied to a wide range of specimens; it is efficient, expeditious, and cost-effective in molecular diagnosis and research. The same solutions and protocol can be used to isolate DNA from different human samples such as urine, saliva, buccal swab, and cell lines.

PCR RFLP is a widely used genotyping method today. The SNP analyses of human samples play an important role in disease diagnosis13 pharmacokinetics14, 15 and many other fields. The polymerase chain reaction needs high purity DNA, and it will fail if undesirable chemicals are present. Hence, PCR RFLP16 genotyping was chosen to ensure the high quality of DNA acceptable for molecular analysis. ARMS17, another method of genotyping that uses allele-specific primers for polymerase chain reaction, also needs good quality, contaminant-free DNA samples. High Resolution Melt18, 19 is a real-time gene variant analysis method that works on the principle that when a saturated dye is dissociated from a double-stranded DNA the decrease in the intensity of the signal is recorded and the minor difference due to a base pair change is compared with a reference fragment of known sequence.

The main objective in the development of this two-step DNA isolation method is to (i) avoid repeated blood sample collection from patients, (ii) use unwanted blood clot sample as a source for genetic analysis, (ii) use noninvasive samples for genetic analysis, (iv) use long stored blood samples for genetic analysis, (v) reduce the time and cost for DNA isolation per sample, and (vi) reduce the use of multiple methods/kits in laboratories.

A wide range of human specimens that include fresh blood, stored blood, clotted blood, lymphocytes, cell lines, saliva, and urine were considered for genomic DNA isolation in this two-step DNA isolation method. The isolated DNA was tested for suitability in PCR-based genetic analytical studies as PCR RFLP, ARMS, and High Resolution Melt (HRM) analysis.  As the proposed method covers a wide range of sample types and yields high quality DNA, it proves advantageous over existing commercial and conventional methods.

Materials and Methods

Reagents

Cell lysis buffer is prepared with 150mmole/L NaCl, 2% SDS, 50mmole/L EDTA, proteinase K (50ng/µl) (Himedia) chloroform, and ethanol (sigma).

Human specimen

Human specimens like fresh blood, fresh blood clot, stored blood sample, saliva sample, urine, lymphocytes, and cell lines were used to isolate DNA. Human blood, saliva, and urine samples were obtained from volunteers after obtaining written consent. The study was approved by Institutional Ethical committee, SRM Medical College Hospital and Research Centre, SRM University, Chennai

Sample collection and processing

In our work, each human specimen was processed in the following ways.

Blood clot 

After removing excess serum from the collection vials, blood clots were weighed and approximately 0.1–0.2 grams of clot was taken and mechanically disrupted using micro tips until it turned into a semi-liquid state; separate tips can be used for different samples to avoid cross contamination.

Blood sample–200µl of fresh/stored blood was taken and lysis buffer added, followed by the DNA isolation procedure.

Finger prick method

10 to 30µl of blood was collected using a pipette from the finger prick and double the volume of lysis buffer was added; then the DNA isolation procedure was followed.

Urine sample 

50 mL of first-morning urine was collected and centrifuged at 10,000 rpm for 15 mi at room temperature. The pellet obtained was washed with 1x PBS and again centrifuged at 5000 rpm for 5 min at room temperature. The resulting pellet was dissolved in 100µl of 1X PBS buffer and this cell suspension was taken in a microfuge tube for DNA isolation.

Saliva sample 

Saliva samples (approximately 500µl) can be collected directly in microfuge tubes and the proposed procedure can be followed. To validate whether the method is applicable for stored saliva samples, the saliva samples were stored at room temperature for 4 days and DNA isolation was performed everyday up to 4 days.

Cell lines 

Adherent cells were trypsinized using 0.5% trypsin and detached from the culture vessel. The suspension was centrifuged at 5000 rpm for 5 min to remove medium and trypsin. To the obtained cell pellet the lysis buffer was added directly. The cell lines U87 (glioblastoma) and A431 (skin carcinoma) used in this work were purchased from NCCS Pune, India.

Lymphocyte 

Fresh blood was taken and lymphocytes were isolated using the ficoll-hypaque method.20 200 to 300µl of buffy coat retrieved from this method can be directly used for DNA isolation.

Gram-Negative Bacteria

Sporosarcina pasteurii SRMNP1 (accession number- KF214757), E.coli Top10 (MTCC, Chandigarh, India) were used for analysis. 1.5 mL of overnight culture was taken and centrifuged at 8000 rpm for 10 min. The supernatant was discarded and the pellet obtained was considered for bacterial genomic DNA isolation by the same procedure as for human specimen.

DNA isolation procedure

Cell lysis – Appropriate human specimen (fluid sample ≈ 200µl or clot – 200 mg, for bacteria 1 mL overnight culture taken and pelleted) was taken in a microfuge tube and 400µl of lysis buffer was added to it (in finger prick method, for10µl blood sample 20 µl of lysis buffer was added), then 2uL (50ng/µl) of proteinase K was added, and the tube was incubated at 55–60⁰ C for 1 h. After incubation 1 µl of proteinase K was added to the tube and mixed well. The tubes were incubated for 5 min at 55⁰C. Then 150 µl of 6M NaCl and 600 µl of chloroform were added to it.  The tubes were mixed gently by inverting them and then centrifuged at 5000 rpm for 5 min at room temperature.

DNA recovery -The aqueous phase was recovered and added to a fresh tube containing 800uL of 90% ethanol. The tube was then centrifuged at 5000 rpm for 5 min at room temperature. The supernatant was discarded and to the pellet 70% ethanol was added and centrifuged at 10,000 rpm for 5 min at RT. The pellet obtained was air dried and dissolved with TE buffer. For better stability the samples can be stored at -20⁰ C. The obtained genomic DNA was visualized using 0.8% agarose gel. The DNA was quantified using Nanodrop lite spectrophotometer (Thermo scientific)

Stability and Integrity

The DNA samples isolated by this method were tested for integrity and stability under various storage conditions. The samples were stored at room temperature (30°C approximately), 4°C, and -20° C for a period of 1 month and the quality of DNA was analyzed through agarose gel electrophoresis.

PCR RFLP Genotyping

The PCR for exon 8 of SCARB1 gene was done for the DNA samples isolated by this method with thermal cycles of 95°C – 30s, 71.5°C – 30 s, and 72°C – 30 s for 35 cycles using forward primer 5’CCTTGTTTCTCTCCCATCCTCACTTCCTCGACGC3’ and reverse primer 5’CACCACCCCAGCCCACAGCAGC 3’.21 Restriction digestion was carried out with the reaction mix containing 10µl of PCR product, 0.1µl of Hin1I (10U/ µl) (thermo scientific), 2 µl of 10x buffer, and 7.9µl of double distilled water.

Allele-specific PCR – ARMS

Amplification refractory mutation system – Tetra primer PCR is a one-step approach used widely for genotyping.22 The Paraoxanase gene polymorphism Q192R was considered to corroborate the applicability of the DNA isolation method. The allele-specific primers were designed using primer1 (http://primer1.soton.ac.uk/primer1.html)23 online tool, the outer forward primer – 5’GGAATAGACAGTGAGGAATGCCAGTTAT, outer reverse primer – 5’ACATTTCAGAGATTCACATACTTGCCA, ‘A’ allele-specific primer 5’ ATCACTATTTTCTTGACCCCTACTTCCG, G’ allele-specific primer 5’TAAACCCAAATACATCTCCCAGGCTT were used for ARMS PCR.  The PCR conditions for the reaction are 95°C – 1 min, 60°C – 1 min and 72°C – 1 min for 35 cycles. This specific

segment of exon 6 was amplified and visualized by running in agarose gel electrophoresis for genotyping purpose.

High resolution melt – Mutation screening

High resolution melt analysis is an advanced technique used for genotyping and to screen the recurrent and novel mutations in genomic DNA. LDLR gene exon 10 was considered for elucidating the applicability of gDNA in HRM. The gene-specific primers designed to suit the HRM conditions were used in the experiment.24 The forward primer 5’ AGATGAGGGCTCCTGGTGCGATGCC3’ and reverse primer 5’ GCCCTTGGTATCCGCAACAGAGACA3’ were used to amplify the 5’ segment of exon 10 from three samples of known genotype (GG, GA, AA). The program for PCR is denaturation at 95 ºC for 30 s, annealing at 65 ºC for 30 s and extension at 72 ºC for 30 s; later the amplified product is analyzed by HRM by increasing the temperature from 65ºC to 95ºC, where the critical temperature of HRM for the fragment is between 85°C and 90°C (Light cycler 480, Roche)

Results

DNA yield and quality

In the present work we demonstrate an improvised efficient, quick, and cost-effective DNA isolation from different human specimens and from Gram-negative bacteria (E.coli Top10, Sporosarcina pasteurii SRMNP1) and its pertinence to molecular analysis and other research. The genomic DNA isolated from different samples were visualized under UV trans-illuminator and documented (Figure.1). The yield and quality of DNA are given in table.1.

figure : 1  figure : 1

Click here to View figure

 

Table 1: DNA concentration and A260/A280 ratio for different human specimens and Gram negative bacteria samples

Specimen No.of samples DNA conc. (ng/ µl) ±SD A260/A280  ±SD
Human Specimen
Stored anticoagulated blood 10 57 ± 0.8 1.76 ± 0.3
Blood clot 25 50± 1.3 1.82 ± 0.12
Fresh anticoagulated blood 20 49±4 1.88 ± 0.16
Saliva 12 313±13.5 1.81±0.04
Urine 10 21± 6.2 1.4 ± 0.11
Cell line 2* 1183± 20.1 1.91 ± 0.01
Lymphocyte 10 460± 12.4 1.94 ± 0.01
Gram-Negative bacteria
E.coli 3* 200± 4.0 1.7±0.3
S.pasteurii 3* 200± 4.0 1.7±0.3
*Done in triplicate

SD – Standard deviation

DNA Stability and Integrity

The DNA samples stored at 4°C and -20°C were stable for 1 month, whereas the DNA samples kept at room temperature started degrading (Figure.2.)

figure : 1   figure : 2
Click here to View figure

PCR RFLP Genotyping

PCR for SCARB1 gene was done for the DNA samples isolated by this method with  thermal cycles at 95°C – 30 s, 71.5°C – 30 s, and 72°C – 30 s for 35 cycles; a product of 218 base pairs was obtained from samples of all sources. A base conversion of C>T of rs5888 polymorphism was genotyped with Hin1I restriction enzyme, and the bands were visualized with 2.5% agarose gel electrophoresis (Figure 3).

figure: 3

 figure : 3

Click here to View figure

Allele-specific ARMS tetra primer PCR

DNA isolated from different human specimens was tested for allele-specific primer PCR technique. The results were visualized with 2.5% agarose gel electrophoresis (Figure 4). The DNA quality matched the applicability in allele-specific primer PCR analysis. The genotypes can be clearly differentiated by ARMS PCR using the DNA isolated by this method.

figure : 4    figure : 4

 

Click here to View figure 

High resolution melt – Mutation screening

The DNA samples were subjected to mutation screening of exon 10 of LDLR gene using high resolution melt analysis. The increased intensity of ResoLight high-resolution melting dye with increase in time or cycle indicates the amplification of the fragment with the given sample in the reaction (Figure 5.a). High resolution melt curves are distinctive and conclusive to differentiate heterozygous genotypes (Fig 5.b and c).

figure : 5  figure : 5

Click here to View figure

Discussion

The two-step DNA isolation method is a modified procedure of Kanai’s DNA isolation method used for blood clot.25 This method is employed to isolate gDNA from other human specimens for the first time in our work with a few modifications. The DNA isolated by this method from various specimens yielded a high quality DNA suitable for further downstream PCR-based applications.26 In this work, apart from human specimens the method has been used to isolate gDNA from Gram-negative bacteria with maximum purity.27 The DNA isolated by this method was highly stable when it was stored at 4°C and -20°C, whereas storing at room temperature led to gradual degradation of DNA sample. The applicability of the DNA isolated by the method has been substantiated using various methods such as PCR RFLP, ARMS PCR, and HRM techniques that are widely used in human genetic analysis.28

This two-step isolation method is suitable for up to a minimum volume of 20 µl and can yield good quality DNA and, hence, avoids drawing large volumes of blood from patients. The clotted blood discarded after biochemical analysis can also be used to get better quality DNA. Saliva and first-morning urine, which are noninvasive samples, also yield good quality of DNA by this method.

Storage of blood and other samples is inevitable in molecular research. We isolated DNA in 10 different samples that had been stored at -20°C for 3 years. The quality and quantity of the DNA were not compromised in any respect for the long stored blood samples compared to fresh blood samples. To examine the stability and suitability of saliva sample at room temperature during transportation without ice packages, the samples were stored at RT for 4 days ; the DNA was isolated from these samples everyday till the fourth day and  good quality of DNA was obtained29, 30 (Figure.6). This proves that saliva samples that are transported without ice packs are also suitable for genomic DNA isolation by this method. On the other hand, only the first morning urine samples were suitable for DNA isolation by this method; urine samples collected otherwise were not consistent in yielding DNA with this method.31

figure : 6 figure : 6

 

Click here to View figure

Compared to the organic conventional and commercial kit methods, the two-step method of DNA isolation is efficient and cost-effective. The method involves non-hazardous chemicals and is simple, safe, and easy to follow. Also, the DNA isolated by this method was stable and had good integrity which makes this an ideal method for DNA isolation. There are various methods and kits available for DNA isolation32 that are restricted to specific tissue or sample, whereas our proposed method can be used for a wide range of specimens and also eliminates multiplicity of kits/methods of DNA isolation in the laboratory.

Conclusion

The proposed method is suitable for a wide spectrum of human specimens and also for Gram-negative bacteria samples. It is suitable for cell lines, lymphocytes, fresh blood, clotted blood, low volume blood samples (20 µl), long time stored (3 years at -20°C), short time stored (up to 4 days at RT), invasive type (blood), and noninvasive type (saliva and urine) samples. It is a cost-effective and efficient method compared to existing conventional and commercial methods. The DNA isolated by this method is suitable for further PCR-based mutation analysis research.

References           

  1. Ghatak S, Muthukumaran B, Nachimuthu K. A simple method of genomic DNA extraction from human samples for PCR-RFLP analysis. Journal of Biomolecular Techniques 2013; 24:224–231.
  2. Wong S, Kuei J, Prasad N, Agonafer E , Mendoza A, Pemberton J et al. A simple method for DNA isolation from clotted blood extricated rapidly from serum separator tubes. Clinical Chemistry 2007; 53:522-524.
  3. Sun F, Reichenberger J. Saliva as a source of genomic DNA for genetic studies: review of current methods and applications. OHDM 2014; 13(2):217-222.
  4. Hansen T, Simonsen M, Nielsen F, Hundrup Y. collection of blood saliva and buccal cell samples in a pilot study on the danish nurse cohort comparison of the response rate and quality of genomic DNA. Cancer Epidemiol Biomarkers Prev 2007; 16:2072-2076.
  5. Boom R, Sol A, Salimans M, Jansen L, Dillen P, Noordaa J. Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiology 1990; 28:495-500.
  6. Koppikar P, Mulherkar R. A simple method for extraction of high molecular weight genomic DNA from buccal cells in mouthwash. Indian Journal of Biotechnology 2006; 5:477-481.
  7. Lundblom K, Macharia A, Lebbad M, Mohammed A, Farnert A. High-speed shaking of frozen blood clots for extraction of human and malaria parasite DNA. Malaria 2011; 10:229.
  8. Gupta R, Earley K, Sharma S. Use of human peripheral blood lymphocytes to measure DNA binding capacity of chemical carcinogens. Proc. Nati. Acad. Sci. USA 1988; 85:3513-3517.
  9. Pinto G, Poloni T, Carneiro L, Baethgen F, Barth L, Pasqualotto A. Evaluation of  different  urine  protocols  and  DNA  extraction  methods  for quantitative  detection  of  BK  viruria  in  kidney  transplant  Journal of virological methods 2013; 188:94–96.
  10. Psifidi A, Dovas I, Bramis G, Lazou T, Russel L, Arsenos G et al. comparison of eleven methods for genomic DNA extraction suitable for large scale whole genome genotyping and long term DNA banking using blood samples. PLoS ONE 2015; 10:1-18
  11. Bali E, Diman A, Bernard A, Roosens H, Keersmaecker J. Comparative study of seven commercial kits for human DNA extraction from urine samples suitable for DNA biomarker-based public health studies. Journal of biomolecular techniques 2014; 25:96–110.
  12. Silva L, Medeiros Z, Soares C, Silva D, Filho D, Melo F. A comparison of four DNA extraction protocols for the analysis of urine from patients with visceral leishmaniasis. Revista da sociedade brasileira de medicina tropical 2014; 47(2):193-197.
  13. Huijsmans R, Damen J, Linden H, Hermans M. Single nucleotide polymorphism profiling assay to confirm the identity of human tissues. Journal of molecular diagnostics 2007; 9(2):205-213.
  14. Berno G, Zaccarelli M, Gori C, Tempestilli M, Antinori A, Perno C et al. Analysis of single-nucleotide polymorphisms (SNPs) in human CYP3A4 and CYP3A5 genes: potential implications for the metabolism of HIV drugs. BMC Medical Genetics2014; 15:76.
  15. Hodel E, Csajka C, Ariey F, Guidi M, Kabanywanyi A, Duong S et al. effect of single nucleotide polymorphisms in cytochrome p450 isoenzyme and N-acetyltransferase 2 genes on the metabolism of artemisinin-based combination therapies in malaria patients from cambodia and tanzania. Antimicrobial agents and chemotherapy 2013; 57(2):950–958.
  16. Yasuo Fukumori, Shiro Ohnoki, Hirotoshi Shibata, Hideo Yamaguchi, Hiroaki Nishimukai Genotyping of ABO blood groups by PCR and RFLP analysis of 5 nucleotide positions, International Journal of Legal Medicine 1995; 107(4):179-182.
  17. Collins A, Ke X. Primer1 Primer Design Web Service for Tetra-Primer ARMS-PCR. The Open Bioinformatics Journal 2012; 6:55-58.
  18. Wittwer CT,Reed GH, Gundry CN, Vandersteen JG, Pryor RJ. High-resolution genotyping by amplicon melting analysis using LCGreen. Clin. Chem. 2003; 49(6):853-860.
  19. Wittwer G. Sensitivity and specificity of single nucleotide polymorphism scanning by high resolution melting analysis. Clinical Chemistry 2004; 50(10):1748-1754.
  20. Denis English, Burton R. Andersen. Single-step separation of red blood cells, granulocytes and mononuclear leukocytes on discontinuous density gradients of Ficoll-Hypaque. Journal of Immunological Methods 1974; 5(3):249-252.
  21. Yin R, Feng D, Miao L, Aung L, Cao X, Yan T et al. Several genetic polymorphisms interact with overweight/obesity to influence serum lipid levels. Cardiovascular diabetology 2012; 11:123.
  22. Masud R. Tetra primer ARMS-PCR relates folate/homocysteine pathway genes and ACE gene polymorphism with coronary artery disease. Mol cell biochem 2011; 355:289–297.
  23. Ye S, Dhillon S, Ke X, Day C. An efficient for genotyping single nucleotide polymorphisms. Nucleic acids research 2001; 29(17):88.
  24. Whittall R, Scartezini M, Li1 K, Hubbart C, Reiner Z, Abraha A et al. Development of a high-resolution melting method for mutation detection in familial hypercholesterolemia Ann Clin Biochem 2010; 47: 44–55.
  25. Kanai N, Fujii T, Saito K, Yokoyama T. Rapid and simple method for preparation of genomic DNA from easily obtainable clotted blood, J Clin Pathol 1994; 47:1043-1044.
  26. Suguna S, Nandal D, Kamble S, Bharatha A, Kunkulol R. Genomic DNA isolation from human whole blood samples by non-enzymatic salting out method. Int J pharm pharm sci 2014; vol 6, issue 6, 198-199.
  27. Torsvik V, Goksoyr J, Daae F. High diversity in DNA of soil bacteria. Applied and environmental microbiology1990; 56:782-787.
  28. Saste S, Ghalsasi P, Kataria R, Joshi B, Mishra B, Nimbkar C. ARMS-PCR as an alternative, cost effective method for detection of FecB genotype in sheep. Indian journal of biotechnology 2012; 11:274-279.
  29. Richardson J, Narendran N, Guymer R, Vu H, Baird N. Blood storage at 4°C—factors involved in DNA yield and quality. J lab clin med 2006; 147(6):290-294.
  30. Daniel P, Koh D, Choo G, Vivian N, Qiuyun F. Effect of storage conditions on the extraction of PCR-quality genomic DNA from saliva. Clinica Chimica acta 2004; 343:191–194.
  31. Hilhorst M, Theunissen R, Rie H, Paassen P, Tervaert J. DNA extraction from long-term stored urine. Hilhorstet al. BMC nephrology 2013; 14:238.
  32. Carpi F, Pietro F, Vincenzetti S, Mignini F, Napolioni V. Human DNA Extraction Methods: Patents and Applications. Recent Patents on DNA & Gene Sequences 2011; 5:1-7.
Visited 1,946 times, 1 visit(s) today
Article Metrics
PlumX PlumX: 
Views Views:  611 Views
PDF Downloads PDF Downloads:  1640

Article Publishing History
Received on: 17 February 2016
Accepted on: 10 April 2016


Share

FOLLOW US ON:

facebook Twitter Mendeley LinkedIn


SEARCH WEBSITE


MEMBER OF

Logo-image


JOURNAL ARCHIVED IN

Logo-image


Visited 1,946 times, 1 visit(s) today