In Vitro Antibacterial, Phytochemical and Molecular Characterization of Moringa oleifera Lam.


Asha Ramachandran1, Rari Vijayan2, Rinu V2 and Dinesh Raj R2*

1Department of Botany, Government College for Women, Thiruvananthapuram, Kerala, India.

2Department of Botany and Biotechnology, Bishop Moore College Mavelikkara, Alappuzha, Kerala, India.

Corresponding Author E-mail:dineshrajr@gmail.com

DOI : http://dx.doi.org/10.13005/bbra/3330

Download this article as:  PDF

ABSTRACT:

Moringa oleifera Lam. popularly called as "miracle tree" is a fast-growing deciduous plant, originated in the Indian subcontinent and is commonly grown in tropical regions. Its extraordinary nutritional profile and a deluge of therapeutic benefits have attracted considerable attention worldwide. The leaves, in particular, are good source of calcium, potassium, proteins and vitamins A, C and E, making them an essential dietary supplement, especially in regions facing food insecurity. The leaves are also rich in antioxidants, including chlorogenic acid, quercetin and beta-carotene, which protect against oxidative stress and cellular damages. This study is an attempt to screen the plant extracts of M. oleifera for its antibacterial activity, qualitative phytochemical constituents and molecular characterization. The results indicate that crude and powdered fresh leaves extract showed no antibacterial activity whereas cold, hot and ethanol extracts, prepared from fresh and dried leaves of M. oleifera showed varying antibacterial properties. Phytochemical analysis revealed the presence of saponins, flavonoids, glycosides, alkaloids, carboxylic acids, coumarins, phenols, quinones, resins, phlobatannins, diterpenes and terpenoids. The study demonstrated efficient antibacterial action against human pathogens which can be attributed to the various phytochemicals present in this plant. To understand the genetic diversity exist in M. oleifera populations, matK and ITS regions were sequenced in five accessions collected from different parts of South Kerala. Five SNPs were detected in the ITS loci and no SNPs were detected in matK loci. Pairwise genetic distance were calculated based on ITS sequences and maximum genetic distance was found between Chengannur and Ochira accessions (0.006) whereas, minimum genetic distance was noted between Chengannur to Kallumala (0.001) and Thiruvananthapuram (0.001). Genetic distance data was subjected to cluster analysis using UPGMA dendrogram. Five accessions were entered into two distinct clusters. Accessions from Chennithala and Ochira were clustered together in one node with a bootstrap support of 98% whereas, the other three accessions, Chengannur, Kallumala and Thiruvananthapuram were clustered together with a boot strap support of 80%. Clustering pattern revealed the genetic structure exist in M. oleifera accessions studied.

KEYWORDS:

Antibacterial; Dendrogram; Moringa oleifera; Phytochemistry; UPGMA

Introduction

Moringa oleifera (Moringaceae) is luxuriously growing in tropical climatic zones and its leaves, fruits and flowers are consumed as vegetables. All the plant parts are utilised for their pharmacological, nutritional and water purifying properties1. Leaves are eaten as vegetables and are used in traditional pharmacology to treat many ailments2. The hepatoprotective3; antidiabetic4; cardioprotective5; anticancer6; antioxidant7; neuroprotective and anti-neuroinflammatory8; anti-asthmatic9; anti-arthritic10; antimicrobial11; anti-ulcer12; CNS activity13; anti-allergic14; wound healing15; analgesic and antipyretic16,17 activities were demonstrated earlier. The phytochemical profile of M. oleifera was reported earlier18. AFLP marker based genetic analysis of seven populations of M. oleifera from Kenya was also documented19.

The population structure and genetic diversity of a global collection of 161 accessions of M. oleifera gathered from Asia, Africa, North and South America, and the Caribbean were also studied using 19 SSR markers and a partial sequence of the chloroplast gene atpB20. Eight Indian cultivars of M. oleifera, from different states in India, were examined for genetic variability using markers like cytochrome P450 gene, ISSR and RAPD21. Clustering pattern was independent of geographic origin of the accessions and concluded the spread of propagules and increased rates of gene flow in the studied area. This investigation aimed to screen the plant extracts of M. oleifera for its antibacterial activity, qualitative phytochemical analysis and molecular characterization of five accessions collected from various localities of South Kerala.

Materials and Methods 

Source Plant

Tender leaves of M. oleifera were obtained from Kallumala region of Mavelikara municipality (Sl. No. 3; Table 1). The fresh and dried leaves are used for the antibacterial and phytochemical analysis. For molecular analysis, five samples were collected directly from home orchards (Table 1).

Table 1: M. oleifera accessions used for molecular studies.

No. Sample Code Geographic origin
1 SR912-CA CHENNITHALA
2 SR912-CR CHENGANNUR
3 SR912-KA KALLUMALA
4 SR912-O OCHIRA
5 SR912-TVPM TRIVANDRUM

 Leaf Extract preparation

100g of leaves were collected and ground using a mortar and pestle. The fresh extract obtained was stored in a clean airtight bottle for antibacterial analysis.10 ml of leaf juice were air dried and 0.1301 g fine powder was obtained and dissolved in DMS, stored in airtight bottle for antibacterial tests. In addition, 10 g of leaves were crushed directly and boiled in 40 ml of distilled water. The extract was stored in a refrigerator and centrifuged after 3 days for 10 minutes at 10,000 rpm. The supernatant obtained was gathered in a clean bottle and stored in a refrigerator. Likewise, 10 g of leaves were crushed in 40 ml cold distilled water and refrigerated. After 3 days, the stored material is centrifuged at 10000 rpm for 10 minutes. The supernatant obtained was stored in refrigerator for further analysis. 10g of dried leaves of M. oleifera were crushed and 40 ml ethanol was added, stored in refrigerator and after 3 days, the extract is centrifuged at 10000 rpm for 10 minutes and stored the supernatant in refrigerator. Similarly, hot water, cold water and ethanol were also carried out in same manner with dried powder too.

Microorganisms

Four bacterial strains were used in the study, namely, Escherichia coli and Salmonella typhi (gram negative) and Bacillus cereus and Staphylococcus aureus (gram positive).

Antibacterial Assay

Bactericidal activity of extracts was checked using agar disc diffusion method and was reported elsewhere22. Test microorganisms i.e., 10 µl from overnight broth cultures were seeded into nutrient agar medium by spread plate method. Agar discs were punched and soaked in plant extracts. Control disc were prepared by soaking in the solvents (negative control).  The discs were inoculated and incubated the plates at 370C for 24 hours and the diameter of the zone of inhibition (mm) is noted. The antibacterial potential of various plant extracts prepared were determined by analysing the zone of inhibition.

Phytochemical Analysis

Extracts from fresh leaf and dried powder using different solvents (hot water, cold water and ethanol) were checked for the presence of various secondary metabolites using the procedure described earlier23,24,25. Major pharmaceutically valuable phytochemical compounds like alkaloids, terpenoids, carboxylic acids, carotenoids, coumarins, lignins, flavonoids, diterpenes, phenols, free amino acids, quinones, resins, saponins, steroids, phytosteroids, tannins, xanthoproteins, glycosides, phlobatannins, proteins, and sugars were screened.

DNA Extraction

Extraction of DNA was carried out with Nucleospin® Plant II Kit (Macherey Nagel) as per instructions provided in the manual. The eluted DNA was stored at 40C and quality and quantity is checked by agarose gel electrophoresis.

PCR Analysis

PCR amplification reactions were done in a 20 µl reaction volume which contained 1X Phire PCR buffer, 0.2mM each dNTPs, 1 µl DNA, 0.2 µl PhireHotstart II DNA polymerase enzyme, 0.1 mg/ml BSA and 3% DMSO, 0.5M Betaine, 5pM of forward and reverse primers (Table 2).

Table 2: Primers used for sequencing.

Loci Primer Name Direction Sequence (5’ à 3’)
mat K 390f Forward CGATCTATTCATTCAATATTTC
1326r Reverse TCTAGCACACGAAAGTCGAAGT
ITS ITS-5F Forward GGAAGTAAAAGTCGTAACAAGG
ITS-4R Reverse TCCTCCGCTTATTGATATGC

DNA amplification was done in a PCR thermal cycler (GeneAmp PCR System 9700, Applied Biosystems). Cycling settings were 980C for 5 minutes and then 40 cycles of 980C (5s), 500C for mat K/580C for ITS (10s), 720C (15s) and final extension at 720C (5 min). PCR products were checked in 1.2% agarose gels. After quality check, PCR products were subjected to ExoSAP-IT Treatment, by mixing 5 µl of PCR products and  2 µl of ExoSAP-IT (GE Healthcare). The mix is incubated for 15 min. at 37°C followed by enzyme inactivation at 80oC for 15 minutes.

Sequencing using BigDye Terminator v3.1

The sequencing process was conducted in a PCR thermal cycler (GeneAmp PCR System 9700, Applied Biosystems) using the BigDye Terminator v3.1 Cycle sequencing Kit (Applied Biosystems, USA), following the company’s instructions. The PCR mix consisted of, 3.2 µM of primer (forward or reverse), 0.28 µl of the sequencing mix, 1.86 µl of 5x reaction buffer, 10 µl of sterile distilled water, and 10–20 ng of ExoSAP treated PCR product. The temperature profile for the sequencing PCR was as follows: 30 cycles for 30 seconds at 96 °C, 40 seconds at 50 °C, and 4 minutes at 60 °C were performed for each primer after an initial cycle that lasted two minutes at 96 °C.

Sequence Analysis

Sequence Scanner Software v1 (Applied Biosystems) and Geneious Pro v5.1 was used for aligning and editing of sequences26. 

Results and Discussion

In vitro Antibacterial Activity

Dried leaf powder extracts have showed no bactericidal property. Cold water extract of fresh leaves showed no antibacterial effect without any zone of inhibition. Hot water extracts of mature fresh leaves displayed meagre activity on E. coli and S. aureus whereas no activity found against S. typhi and B. cereus. Ethanol extract of fresh leaves displayed a relatively better antibacterial assay on B. cereus, E. coli, S. aureus and S. typhi with their distinct diameter zones of inhibition recorded 15 mm, 20 mm, 15 mm, 10 mm respectively. 

Phytochemical Analysis

Hot, cold water and ethanol extracts from fresh and dried leaves were profiled to compare the difference between the treatments in phytochemical elusion. The study demonstrated the presence of common phytoconstituents like tannins, saponins, flavonoids, glycosides, alkaloids, carboxylic acids, coumarins, phenols, quinones, resins, xanthoproteins, phlobatannins, diterpenes, terpenoids, sugars, lignins, carotenoids, proteins and amino acids, sterols and phytosterols from the leaves of M. oleifera. Phytochemical profile of hot and cold water extracts of mature fresh and dry leaves were significantly different in the absence of certain constituents (Table 3). The findings in the study are at par with earlier reports27. Using Gas chromatography-mass spectrometry aided study, the presence of 16 components in the methanolic extract of leaves with highest percentage of 9-octadecenoic acid (20.89%) and L-(+)-ascorbic acid- 2,6-dihexadecanoate (19.66%) was recorded28. The synergistic effect of the phytochemicals may be the reason behind the use of the plant for various ailments, especially in indigenous system of medicine29 and the present results also attested it.

Table 3: Phytochemical profile of M. oleifera

  Fresh leaves Dry leaves
Sl.No. Compounds Hot extract Cold  extract Ethanol Hot extract Coldextract Ethanol
1. Alkaloids + + + + + +
2. Carboxylic acid
3. Coumarins + + + + +
4. Flavonoids + + + + + +
5. Phenols
6. Quinones
7. Resins
8. Saponins
9. Sterols & Phytosterols + + + + +
10. Tannins + +
11. Xanthoproteins
12. Glycosides + +
13. Phlobatannins
14. Diterpenes + + + +
15. Terpenes
16. Carotenoids
17. Lignins
18. Proteins and amino acids +
19. Sugars +

Molecular Diversity

Two gene regions, mat K and ITS, were selected to understand the genetic diversity of five accessions of M. oleifera obtained from various places of South Kerala. The chloroplast region, mat K was selected as a maternally inherited, highly conserved loci, whereas, nuclear gene region, ITS as highly variable and depicts the biparental genetic diversity. Figs. 1 and 2 provide a representative gel image demonstrating the amplification of the two loci examined.

Figure 1: Gel showing the amplification of mat K loci in the five accessions of M. oleifera and run on 1% Agarose gel. The line codes correspond to the code given in Table 1.

Click here to view Figure

Figure 2: Gel showing the amplification of ITS loci in the five accessions of M. oleifera and run on 1% Agarose gel. The line codes correspond to the code given in Table 1.

Click here to view Figure

Sequences were aligned with the help of Geneious software. Five SNPs were detected in the ITS loci. mat K sequences were aligned and no SNPs were detected. Pair wise genetic distance between accessions were calculated based on ITS sequences (Table 4). Maximum genetic distance was noticed between Chengannur and Ochira accessions (0.006) whereas, minimum was found between Chengannur to Kallumala (0.001) and Thiruvananthapuram (0.001). Genetic distance data was subjected to cluster analysis using UPGMA dendrogram (Fig 3). Five accessions were entered into two distinct clusters. Accessions from Chennithala and Ochira were clustered together in one node with a bootstrap support of 98%. Whereas, the other three accessions, Chengannur, Kallumala and Thiruvananthapuram were clustered together in one node with a boot strap support of 80%. A recent report discussed the genetic diversity of Moringa and its importance in the current nutritional security environment30. 164 genotypes of Moringa were identified by employing cluster analysis, principle coordinate analysis (PCoA), 3D plot and phylogenetic tree31. An indepth analysis of the Moringa gene pool for leaf micronutrient and phytochemical properties produced encouraging results32.

Figure 3: UPGMA dendrogram of five M. oleifera accessions based on ITS sequences. Values at the node denotes bootstrap support.

Click here to view Figure

Table 4: Pair wise genetic distance calculated for accessions of M. oleifera

CA-ITS CR-ITS KA-ITS O-ITS TVPM-ITS
CA-ITS 0.000
CR-ITS 0.006 0.000
KA-ITS 0.004 0.001 0.000
O-ITS 0.000 0.006 0.004 0.000
TVPM-ITS 0.004 0.001 0.000 0.004 0.000

The nutritional, therapeutic and industrial significance of M. oleifera was evaluated earlier33. Aqueous, extract of M. oleifera confirms the presence of secondary metabolites including Carbonic acid, Butanedioic acid, Citramalic acid, some esters etc. Also, 54 components were identified in methanolic Moringa leaves extracts, with 1,3-Propanediol, 2-ethyl-2- (hydroxymethyl) and Propionic acid as major components34. It should be noted that a number of factors, including the plant’s cultivation location, soil type, water and fertilizer availability, industrialization process, and storage conditions, affect the phytochemical contents of Moringa. Taking these precedents into account, it can be inferred that the aforementioned reasons account for the variance in the nutritional and functional qualities of M. oleifera from different regions in Kerala.

Conclusion

Antibacterial efficiency of various leaf extracts (fresh and dried leaves) of M. oleifera was examined using Agar disc diffusion method. Dried leaf powder extracts have showed no antibacterial activity. Cold water extract of fresh leaves showed no antibacterial effect while hot water extract exhibited meager activity on E.coli and S. aureus whereas no specific action detected against S. typhi and B. cereus. Ethanol extract of fresh leaves displayed a relatively better bactericidal property on B. cereus, E. coli, S. aureus and S. typhi with distinct individual zones of inhibition measured in diameters documented 15 mm, 20 mm, 15 mm, 10 mm respectively. Different extracts of dried leaves showed no activity against the organisms tested. Qualitative phytochemical analysis of fresh and dry leaves of M. oleifera revealed the occurrence of secondary metabolites like tannins, saponins, alkaloids, carboxylic acids, coumarins, phenols, quinones, resins, xanthoproteins, phlobatannins, diterpenes, terpenoids, sugars, lignins, carotenoids, proteins and amino acids, sterols, phytosterols etc. Phytochemical profile of various extracts from mature fresh and dry leaves were significantly different. One chloroplast and one nuclear gene region, were chosen to observe the phylogenetic interrelationships between five accessions of M. oleifera obtained from different parts of South Kerala. Pair wise genetic distance between accessions were calculated based on ITS sequences. Maximum genetic distance was found between Chengannur and Ochira accessions (0.006) whereas, minimum was noticed between Chengannur to Kallumala (0.001) and Thiruvananthapuram (0.001). Genetic distance data was subjected to cluster analysis using UPGMA dendrogram. Five accessions were entered into two distinct clusters. Accessions from Chennithala and Ochira were clustered together in one node with a bootstrap support of 98%. Whereas, the other three accessions Chengannur, Kallumala and Thiruvananthapuram were clustered together in one node with a boot strap support of 80%. Genetic characterization studies identified high genetic diversity in nuclear loci and no genetic variation at the chloroplast loci. These results will be helpful for future research endeavors that attempt to investigate the numerous biological potentials of M. oleifera.

Acknowledgment

The authors would like to thank Rajiv Gandhi Centre for Biotechnology, Thiruvananthapuram for permitting the Molecular Biology laboratory works and CEPCI Laboratory & Research Institute, Kollam for Anti-bacterial Assays. The authors are thankful to the Principal, Bishop Moore College, Mavelikkara for providing facilities for other work components.

Funding Sources

The author(s) received no financial support for the research, authorship, and/or publication of this article.

Conflict of Interest

The authors do not have any conflict of interest.

Data Availability Statement

This statement does not apply to this article.

Ethics Statement

This research did not involve human participants, animal subjects, or any material that requires ethical approval.

Informed Consent Statement

This study did not involve human participants, and therefore, informed consent was not required.

Author Contributions

Rari Vijayan, Rinu V : carried out the antibacterial and phytochemical assays.

Dinesh Raj R : written the initial form of the manuscript.

Asha Ramachandran and Dinesh Raj R :did the molecular works and finalized the manuscript. 

References

  1. Devkota S., Bhusal, K. K. Moringa oleifera: A miracle Multipurpose tree for agroforestry and climate change mitigation from the Himalayas – A review. Cogent Food Agric. 2020; 6(1):1805951.
    CrossRef
  2. Sultana S. Nutritional and functional properties of Moringa oleifera. Metabol Open. 2020; 8:100061.
    CrossRef
  3. Saki M., De Villiers H., Ntsapi C., Tiloke C. The Hepatoprotective Effects of Moringa oleifera against Antiretroviral-Induced Cytotoxicity in HepG2 Cells: A Review. Plants. 2023; 12(18):3235.
    CrossRef
  4. Mthiyane F. T., Dludla P. V., Ziqubu K., Mthembu S. X. H., Muvhulawa N., Hlengwa N., Nkambule B. B., Mazibuko-Mbeje S. E. A Review on the Antidiabetic Properties of Moringa oleifera Extracts: Focusing on Oxidative Stress and Inflammation as Main Therapeutic Targets. Front. Pharmacol. 2022; 13: 940572.
    CrossRef
  5. Alia F., Putri M., Anggraeni N., Syamsunarno M. R. A. A. The Potency of Moringa oleifera Lam. as Protective Agent in Cardiac Damage and Vascular Dysfunction. Fron. Pharmacol. 2022; 12:724439.
    CrossRef
  6. Abd-Rabou A. A., Abdalla A. M., Ali N. A., Zoheir K. M. Moringa oleifera Root Induces Cancer Apoptosis more Effectively than Leave Nanocomposites and Its Free Counterpart. Asian Pac. J. Cancer Prev. 2017; 18(8):2141-2149.
  7. Peñalver R., Martínez-Zamora L., Lorenzo J. M., Ros G., Nieto G. Nutritional and Antioxidant Properties of Moringa oleifera Leaves in Functional Foods. Foods. 2022; 11(8):1107.
    CrossRef
  8. Azlan U. K., Annuar N. A. K., Mediani A., Aizat W. M., Damanhuri H. A., Tong X., Yanagisawa D., Tooyama I., Ngah W. Z. W., Jantan I., Hamezah H. S.  An insight into the neuroprotective and anti-neuroinflammatory effects and mechanisms of Moringa oleifera. Front. Pharmacol. 2023; 13:1035220.
    CrossRef
  9. Agrawal B., Mehta A. Antiasthmatic activity of Moringa oleifera Lam: A clinical study. Indian J. Pharmacol. 2008; 40(1):28-31.
    CrossRef
  10. Fatima N., Fatima S. J. Pharmacological screening for anti-arthritic activity of Moringa oleifera. Asian J. Pharm. Clin. Res. 2016; 9(3):106-111.
  11. Fouad E. A., Elnaga A. S. M. A., Kandil M. M. Antibacterial efficacy of Moringa oleifera leaf extract against pyogenic bacteria isolated from a dromedary camel (Camelus dromedarius) abscess. Vet World. 2019; 12(6):802-808.
    CrossRef
  12. Paricharak S., Hugar S. Evaluation of antiulcer activity of Moringa oleifera pods extract. Eur. J. Pharm. Med. Res. 2020; 7(6):702-708.
  13. Bakre A. G., Aderibigbe A. O., Ademowo O. G. Studies on neuropharmacological profile of ethanol extract of Moringa oleifera leaves in mice. J. Ethnopharmacol. 2013; 149: 783-789.
    CrossRef
  14. Rani N. Z. A., Kumolosasi E., Jasamai M., Jamal J. A., Lam K.W., Husain K. In vitro anti-allergic activity of Moringa oleifera Lam. extracts and their isolated compounds. BMC Complement. Altern. Med. 2019; 19:361.
    CrossRef
  15. Shady N. H., Mostafa N. M., Fayez S., Abdel-Rahman I. M., Maher S. A., Zayed A., Saber E. A., Khowdiary M. M., Elrehany M. A., Alzubaidi M. A., Altemani F. H., Shawky A. M., Abdelmohsen U. R. Mechanistic Wound Healing and Antioxidant Potential of Moringa oleifera Seeds Extract Supported by Metabolic Profiling, In Silico Network Design, Molecular Docking, and In Vivo Studies. Antioxidants. 2022; 11(9):1743.
    CrossRef
  16. Martínez-González C. L., Martínez L., Martínez-Ortiz E. J., González-Trujano M. E., Déciga-Campos M., Ventura-Martínez R., Díaz-Reval I. Moringa oleifera, a species with potential analgesic and anti-inflammatory activities. Biomed. Pharmacother. 2017; 87:482-488.
    CrossRef
  17. Hukkeri V. I., Nagathan C., Karadi R., Patil B. S. Antipyretic and wound healing activities of Moringa oleifera Lam. in rats. Indian J. Pharm. Sci. 2006; 68(1):124-126.
    CrossRef
  18. Anwar F., Latif S., Ashraf M., Gilani A. H. Moringa oleifera: A food plant with multiple medicinal uses. Phytother. Res. 2007; 21(1):17-25.
    CrossRef
  19. Muluvi G. M., Sprent J. I., Soranzo N., Provan J., Odee D., Folkard G., McNicol J. W., Powell W. Amplified fragment length polymorphism (AFLP) analysis of genetic variation in Moringa oleifera Lam. Mol. Ecol. 1999; 8(3):463-470.
    CrossRef
  20. Shahzad U., Khan M. A., Jaskani M. J., Khan I. A., Korban S. S. Genetic diversity and population structure of Moringa oleiferaConserv. Genet. 2013; 14(6):1161-1172.
    CrossRef
  21. Saini R. K., Saad K. R., Ravishankar G. A., Giridhar P., Shetty N. P. Genetic diversity of commercially grown Moringa oleifera Lam. cultivars from India by RAPD, ISSR and cytochrome P450-based markers. Pl. Syst. Evol. 2013; 299(7):1205-1213.
    CrossRef
  22. Balouiri M., Sadiki M., Ibnsouda S. K. Methods for in vitro evaluating antimicrobial activity: A review. J. Pharm. Anal. 2016; 6(2):71-79.
    CrossRef
  23. Harborne, J. B. (ed): Phytochemical Methods: A Guide to Modern Techniques of Plant Analysis, 3rd edn. 1998: Chapman and Hall, London
  24. Banu K. S., Cathrine L. General Techniques Involved in Phytochemical Analysis. Int. J. Adv. Res.Chem. Sci. 2015; 2(4):25-32.
  25. Siddiqui A., Moid H. An Introduction on Phytochemical Analysis and their Types. Der Pharmacia Lettre. 2022; 14(2): 01-05.
  26. Kearse M., Moir R., Wilson A., Stones-Havas S., Cheung M., Sturrock S., Buxton S., Cooper A., Markowitz S., Duran C., Thierer T., Ashton B., Meintjes P., Drummond A. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012; 28(12), 1647-1649.
    CrossRef
  27. Anzano A., Ammar M., Papaianni M.; Grauso L., Sabbah M., Capparelli R., Lanzotti V. Moringa oleifera Lam.: A Phytochemical and Pharmacological Overview. Horticulturae. 2021; 7(10):409.
    CrossRef
  28. Aja P. M., Nwachukwu N., Ibiam U. A., Igwenyi I. O., Offor C. E., Orji, U. O. Chemical constituents of Moringa oleifera leaves and seeds from Abakaliki, Nigeria. Am. J. Phytomed. Clin. Ther. 2014; 2(3): 310-321.
  29. Kumar S., Murti Y., Arora S., Akram W., Bhardwaj H., Gupta K., Sachdev A., Devi J., Kumar S., Kumar B., Dwivedi V., Sameem S., Kumar N. P., Singh K., Saha S. Exploring the therapeutic potential of Moringa oleifera Lam. in Traditional Chinese Medicine: A comprehensive review. Pharmacol. Res. – Mod. Chin. Med. 2024; 12:100473.
    CrossRef
  30. Lakshmidevamma T. N., Ugalat J., Apoorva K. A., Suresh S. P. G., Doddamani M., Kadam S., Nayana R. S., Jagadeesha R. C., Fakrudin B. Genetic Diversity of Moringa (Moringa Oleifera Lam.). In: The Moringa Genome (Boopathi, N.M., Raveendran, M., Kole, C. (Eds.). Springer International Publishing. 2021; pp 57-65.
    CrossRef
  31. Ondieki S. K., Hunja C. W., Muluvi G. M., Korir J. C., Mutiso F., Kitheka J. U., Kioko D., Kimatu J., Ndufa J. K., Mutati K. Genetic diversity of selected Moringa oleifera Lam. Provenances from the coastal region of Kenya. Magna Scientia Adv. Res. Rev. 2023; 08(02):118-128.
    CrossRef
  32. Mandal S., Shankar R., Rao K., Kalaivanan D., Kumar P. C., Dutta S. Genetic dissection of Moringa (Moringa oleifera L.) gene pool for leaf micronutrient and phytochemical qualities for bio-fortification. Genet. Resour. Crop. Evol. 2024; https://doi.org/10.1007/s10722-024-02113-0.
    CrossRef
  33. Saini R. K., Sivanesan I., Keum Y. S. Phytochemicals of Moringa oleifera: a review of their nutritional, therapeutic and industrial significance. Biotech. 2016; 6(2):203.
    CrossRef
  34. Bhalla, N., Ingle N., Patri S. V., Haranath D. Phytochemical analysis of Moringa oleifera leaves extracts by GC-MS and free radical scavenging potency for industrial applications. Saudi J. Biol. Sci. 2021; 28(12):6915-6928.
    CrossRef

Visited 724 times, 1 visit(s) today
Article Metrics
PlumX PlumX: 
Views Views:  484 Views
PDF Downloads PDF Downloads:  989

Article Publishing History
Received on: 22-08-2024
Accepted on: 22-10-2024

Article Review Details
Reviewed by: Dr. Durgesh Ranjan Kar
Second Review by: Dr. Sabiha Khan
Final Approval by: Dr Jahwarhar Izuan Bin Abdul Rashid


Share

FOLLOW US ON:

facebook Twitter Mendeley LinkedIn


SEARCH WEBSITE


MEMBER OF

Logo-image


JOURNAL ARCHIVED IN

Logo-image


Visited 724 times, 1 visit(s) today