Analysis of Glycine Receptors Genetic Polymorphisms in Patients with Schizophrenia


Mehdipour Saeid*1, KordiTamandani DorMohammad1 and Rigi Esmat1
Department of Biology, University of Sistan and Baluchestan, Zahedan, IR Iran.

DOI : http://dx.doi.org/10.13005/bbra/2366

Download this article as:  PDF

ABSTRACT:

Schizophrenia is a complex and debilitative mental disorder. There are some evidences indicating that there is a genetic linkage between Glycine receptors gene and schizophrenia incidence. This project evaluated the linkage between the three SNP of Glycine receptors gene in schizophrenia patients. A total of 113 patients including 16 women and 98 men were studied. The control group consisted of 117 healthy individuals (9 women and 108 men) with a mean age of 46.70+11.716 years, who was unrelated to SZC patients. We tried to select healthy individuals among people without any mental disorders. Results of all rs2229963، rs111946619 and rs78179793 SNPs showed that there is not any significant linkage between the incidence of this single nucleotide polymorphisms and risk of schizophrenia(rs2229963, P=0.934, rs111946619, P=0.780 and rs78179793, P=0.393) . We conclude that those SNPs are not suitable candidates to be considered as causes for schizophrenia incidence.

KEYWORDS:

Schizophrenia; Glycine receptors gene; Polymorphism

Introduction

The history of our evolving understanding of the pathophysiology of psychiatric disorders is complex and affected by the changing concepts of psychiatric disease and advances in neuroscience[1, 2]. Schizophrenia is a devastating mental disorder and roughly 1% of the world population suffers schizophrenia. The evolution of symptoms occurs in young age, the second and third decades of life. It is a hereditary disease and studies indicate that close relatives face a quadruple higher risk. Urban life is a schizophrenia risk factor and men are 30% at a higher risk than women.In men schizophrenia usually starts between 15-24 years old which means 3-5 years earlier than women. Women experience the second onset at age 45-54 which is said to be related to Estrogen level[3, 4]. Numerous studies indicated that aggression and homicide are more frequent in schizophrenia than in the general population. Individuals with a major psychiatric disorder, most commonly schizophrenia, commit 5.2% of severe acts of violence[5].Keapline and Bluer were the first to suggest schizophrenia is a mental disorder which needs better recognition. Now research focuses on three regions of the brain: frontal cortex, Thalamus and medial temporal lobe[6].Study is limited about schizophrenia due to many reasons. Defect in schizophrenia permeability and common symptoms of the disorder can be the result of drug abuse or other diseases. In addition, schizophrenia threshold limit is uncertain and can be related to place in one family but irrelevant in another[7].The first valid document about genetics relation with schizophrenia was provided by Sherrington et al. in 1988. But it can’t be repetitive in independent researches. As a result, research on the links reveals some Chromosome regions 1q21-22، 1q32-41، 4q31، 5p13-14، 5q22-31، 6p22-24، 6q21-22، 8p21-22، 9q21-22، 10p11-15، 13q14-32،15q15، 22q11-13 و Xp11 as the volunteer location for schizophrenia[8].

Many dopamine neurotransmitters (dopamine, glutamate, serotonin, GABA) and the interaction between many of the brain regions (Thalamus, Hippocampus, Frontal cortex) seems to affect schizophrenia neuropathology[9].The major brain regions related to schizophrenia are: Limbic system, Frontal lobes and basic nodes. The three regions are reciprocally connected in a way that the disorder in one region may relate to a primary damage to another region. Thalamus and brain stem are into play because of an integrative role of Thalamus and the fact that brain stem and medial section are the first station of upper motor aminergic neurons. Therefore, brain imaging of live people and Pathological investigation of brain tissue after death indicates that limbic system is the most probable station of primary pathological procedure at least in schizophrenia patients and most of the schizophrenia patients[10]. Studies have suggested that schizophrenia might result from a neurotransmission hypofunction of glutamatergic and N methyl–d-aspartate (NMDA) receptors[11-13]. In a major paradigm shift on the etiology of schizophrenia, it has been proposed that abundant genetic and environmental risk factors Together on the N-methyl-D-aspartate receptors (NMDAR)-mediated glutamatergic system and result in NMDAR hypofunction in the limbic system during neurodevelopment

Studies have suggested that schizophrenia might result from a neurotransmission hypofunction of glutamatergic and N Methyl– d-aspartate (NMDA) receptors[11-14].

Glycine is an inhibitory neurotransmitter in the CNS and acts as a N-methyl-d-aspartate (NMDA) glutaminergic receptor potential of increasing growth hormone and intervenes in the proper function of immune system. It also plays an important role in relieving and improving the damaged tissue. Glycine (2gr a day) along with other neuroleptics is an additional therapy for schizophrenia. Glycine as an inhibitory eurotransmitter is potential of managing neurotic disorders, Hyperactivity, convulsion, depression and bipolar disorder (phase mania)[15]. Glycine can easily pass blood brain barrier and affect the center of the brain. Generally, Glycine affects its second receptors and acts as a medium of responding. The first recognized receptor of Glycine which is a strychnine sensitive receptor is located in the spine and lower that the brain stem[16, 17]. Glycine is an inhibitory neurotransmitter in the brain and spine. Glycine receptors have to subunits of Glycine-A and Glycine-B. The subunit Glycine-A includes units a and b. Again the subunit a includes a1, a2, a3 and a4 isoforms. A b unit acts as a junction Glycine receptors to sub synaptic sytoskeleton which is facilitated by sytoplasmic proteins called gephyrin[16]. On the other hand, the sub unit of Glycine-b   is a receptor that is not sensitive to strychnine which acts as a facilitator in the location of Glycine attachment to glutaminergic[18]. Glycine acts as a medium by its Glycine-A activity. It also is essential for Ca prevalence NMDA receptor activity along with Glutamic acid[19].

Materials and Methods

Study subjects

The case -control study was carried out from December 2012 to September 2013 in mental hospital in EsfehanProvince. Therelatedstudies, twoindependent samples were examined:  the cases group included 114 patients with schizophrenia (98 men and 6 women)with the average age of 43.29± 12/13 years. The control group including 117 healthy individuals (108 males and 9 females) with the average age of 43.2±12.32 years.

DNA isolation and polymerase chain reaction (PCR)

For genotypic analysis, blood samples were collected in Na-EDTA tubes for DNA extraction then stored at –20 °C. carried genomic DNA extraction from blood samples. Polymorphisms were identified by PCR using the Tetra Amplification Refractory Mutation System (ARMS), a simple and rapid detection method for different types of mutations.Amplification of rs78179793, rs111946619 and rs2229963 were set according to the following  PCR conditions: 10 µl of premix, 1.5µl of DNA, 1µl of both primer (Reverse outer, Forward outer) and 2µl of both primer (Forward inner،Reverse inner) and 2.5µl of  pure water. The PCR was heated at 95°C for 10 min, followed by 30 cycles at 94°C for 30 s, annealing at 47°C, 50.8°C and 65°Cfor rs78179793, rs111946619 and rs2229963 for 30 s, extension at 72°C for 30 s and final extension by incubation at 72°C for 10 min. All of annealing temperature and primers sequence are shown in table 1.

Table 1: Primers sequence and annealing temperature of rs78179793, rs111946619 and rs2229963

SNP Primer type Orientation Primer    Sequence(5ʹ→3ʹ) TmᵒC
Outer primers Forward CTGAAAAGTTAATCAACTGTATCTGTTCCA 47
rs78179793 Reverse CACAAACTTCTTCTTGATAGCATCTCC 47
Inner primers Forward CTGTCTTTATTCCGTCAGGAAGAATAC 47
Reverse TAAAATTAAAACGACTTTCACGAGTACCA 47
Outer primers Forward GCCCTGAGTTGGAGCTTAGATTTCATTATT 50.8
rs111946619 Reverse AGGGAATGAGTTGTAAGGGTCCTTTCTCT 50.8
Inner primers Forward TTTGTTTGCTAAGACTCACCTTGCCC 50.8
Reverse TCTTCAAGTCCATGGGACAGGATCAA 50.8
Outer primers Forward AAACAACGTGGGATAATGGAATTGGAAAT 65
rs2229963 Reverse ATCGTTAAGACTGTGGTGATGCCCAG 65
Inner primers Forward AAGTTTACCTGCATTGAGGTCAAGTTTAAC 65
Reverse TCAAATAATATCCCATTTGGCGTTCCCGA 65

 

Statistical analysis

Categorical data were analyzed using the chi-square test. Differences forcontinuous variables were evaluated using the Student’s t-test. Data are presented as mean±standard deviation (SD). The software SPSS V19 was used to evaluate the statusof the risk allele in patients and controlled ones. The significance level of these analyses obtained from the SNP V19 was set as p value <0.05 after 100.000 permutation tests.

Table 2: Number and frequency of glycinreceptorʹs SNP in cases and controls.

SNP Cases

N=99

Controls

N=79

OR CI P value
rs78179793
CT 95(94.95) 77(97.47) Reference
CC 4(5.05) 2(2.53) 1.62 0.2249, 18.32 0.393
CC+CT 99 79 1.01 0.6518, 1.583 0.94
rs111946619
CT 97(96.97) 76(96.2) Reference
CC 3(3.03) 3(3.8) 0.8 0.1022, 6.025 0.780
CC+CT 99 79 1.00 0.6302, 1.53 0.93
rs2229963
CT 96(95.96) 76(96.2) Reference
CC 3(4.04) 3(3.8) 1.263 0.1643, 9.7 0.934
CC+CT 99 79 1.25 0.1631, 9.603 0.8

 

Discussion

Genetic studies showed that the glycine modulators site on the NMDA receptor is a considerable target for improving cognition and associated negative symptoms in schizophrenia, also manipulation of modulating sites of the NMDAR could be successful in the treatment of schizophrenia[20, 21]. NMDARs are widely thought to be crucial in synaptic plasticity and circuit formation for pre- and early postnatal stages of brain development, otherwise known as the “critical developmental window.” Numerous studies have indicated that the maturation of brain circuitry is usually coincident with the NMDAR subunit switch (e.g., NR2B-to-NR2A and NR3A-to-NR3B) that occurs at the onset of the critical period of development[1, 22]

Indeed, the NMDAR-mediated glutamatergic model provides an alternate approach for conceptualizing the brain abnormalities associated with schizophrenia[13, 23].

But according to this study we found there is not any meaningful relationship between this positions and schizophrenia. And another study by Burnet in 2008 confirms our study.

Fourth dysregu- lated NMDAR subunits are usually seen in postmortem tissue from patients with schizophrenia and in animal models of NMDAR antagonism[24-27].

JaromirHons and his colleagues in 2010 with the hypothesis that the level of negative symptoms in schizophrenia is associated with a glycine, glycine on serum levels have begun to study this disease. in this study, 50 patients and 50 healthy controlled ones were enrolled.

in this study, a significant reduction was observed in serum levels of glycine in comparison to healthy onesand this difference was observed only in men.

In this study, Glaycen serum levels which contained all glaycein genes expression was examined. But in our study, we examined only three positions on semi-autosome of  X chromosomeAnd no significant correlation was found between the three positions and schizophrenia.

References

  1. Ghaemi, S.N., Paradigms of psychiatry: eclecticism and its discontents. opinion in psychiatry, 2006. 19(6 ): p. 619–624.
  2. Kalina Boteva, J.L., Reconsidering the Classification of Schizophrenia and Manic Depressive Illness — A Critical Analysis and Mew Conceptual Model. The World Journal of Biological Psychiatry, 2003. 4(2): p. 81-92.
    CrossRef
  3. Häfner, H., Gender differences in schizophrenia. Psychoneuroendocrinology, 2003. 28: p. 17–54.
    CrossRef
  4. Pekka Tienari , L.C.W., Anneli Sorri, Ilpo Lahti, Kristian Läksy, Juha Moring, Mikko Naarala, Pentti Ni minen, Karl-Erik Wahlberg Genotype-environment interaction in schizophrenia-spectrum disorder. the British journal of psychiatry, 2004. 184(3).
  5. Seena Fazel, N.L., Anders Hjern, Martin Grann, Paul Lichtenstein, Schizophrenia, Substance Abuse, and Violent Crime. , jama psychiatry formerly archives of general psychiatry, 2009. 301(19): p. 2016-2023.
  6. Elena Antonova, T.S., Robin Morrisc, Veena Kumari, The relationship between brain structure and neurocognition in schizophrenia: a selective review. Schizophrenia Research, 2004. 70(2-3): p. 117–145
    CrossRef
  7. Isabelle M. Rosso, T.D.C., Tiia Huttunen, Matti O. Huttunen, Jouko Lïvist, Timothy L. Gasperoni, Obstetric Risk Factors for Early-Onset Schizophrenia in a Finnish Birth Cohort. American journal of psychiatry, 2000. 157(7): p. 801-807.
    CrossRef
  8. Marie-Pierre Bonnet, V.M., Karim Asehnoune, Delphine Bridoux, Joséphine Poggi-Bach, Jacques Duranteau, Dan Benhamou, Glycine and ammonia plasma concentrations during sedation with remifentanil in critically ill patients. Intensive Care Medicine, 2007. 33(7): p. 1179-1182.
    CrossRef
  9. Jaana M. Suvisaari, J.K.H., Antti J. Tanskanen, Jouko K. Lönnqvist Decline in the Incidence of Schizophrenia in Finnish Cohorts Born From 1954 to 1965. jama psychiatry formerly archives of general psychiatry, 1999. 56(8).
  10. Sadock, B.J.S.a.V.A., comprehensive textbook of psychiatry. 2000. 1,96,1230.
  11. Coyle, G.T.a.J.T., Glutamatergic Mechanisms In Schizophrenia. Annual Review of Pharmacology and Toxicology, 2002. 42: p. 165-179.
    CrossRef
  12. Paul J Harrison, M.J.O., Genes for schizophrenia? Recent findings and their pathophysiological implications. The Lancet, 2003. 361(9355): p. 417–419.
    CrossRef
  13. Weinberger, P.J.H.a.D.R., Schizophrenia genes, gene expression, and neuropathology: on the matter of their convergence. Molecular Psychiatry, 2005: p. 40–68.
  14. Gao, M.A.S.a.W.-J., NMDA hypofunction as a convergence point forprogression and symptoms of schizophrenia. frontiers in CELLULAR NEUROSCIENCE, 2013. 7.
  15. Robb T. Brumfield, P.B., Deborah A. Nickerson, Scott V. Edwards, The utility of single nucleotide polymorphisms in inferences of population history. trends in ecology & evolution, 2003. 18(5): p. 249–256.
    CrossRef
  16. Lynch, J.W., Molecular Structure and Function of the Glycine Receptor Chloride Channel. Physiological Reviews, 2004. 8: p. 1051-1095
    CrossRef
  17. Zhenglin Jiang , K.K., Fushun Wang , Jiang Hong Ye Taurine Activates Strychnine-Sensitive Glycine Receptors in Neurons Freshly Isolated From Nucleus Accumbens of Young Rats. Journal of Neurophysiology, 2004. 91: p. 248-257
    CrossRef
  18. Viviane Labrie, J.C.R., The involvement of the NMDA receptor d-serine/glycine site in the pathophysiology and treatment of schizophrenia. Neuroscience & Biobehavioral Reviews, 2010. 34(3): p. 351–372.
    CrossRef
  19. Parsons, W.D.a.C.G., Glycine and N-Methyl-D-Aspartate Receptors: Physiological Significance and Possible Therapeutic Applications. Pharmacological reviews, 1998. 50: p. 597-664.
  20. Jablensky, A., Epidemiology of schizophrenia: the global burden of disease and disability. European Archives of Psychiatry and Clinical Neuroscience, 2000. 250(6): p. 274-285.
    CrossRef
  21. Tyrone D. Cannon, J.K., Jouko Lönnqvist, Matti Huttunen, Markku Koskenvuo, The Genetic Epidemiology of Schizophrenia in a Finnish Twin Cohort A Population-Based Modeling Study. jama network formerly archives of general psychiatry, 1998. 55: p. 67-74.
    CrossRef
  22. Gao, H.-X.W.a.W.-J., Cell Type-Specific Development of NMDA Receptors in the Interneurons of Rat Prefrontal Cortex. Neuropsychopharmacology, 2009: p. 2028–2040.
  23. John E. Lisman, J.T.C., Robert W. Green, Daniel C. Javitt, Francine M. Benes, Stephan Heckers, Anthony A. Grace, Circuit-based framework for understanding neurotransmitter and risk gene interactions in schizophrenia. trends in neurosciences, 2008. 31(5): p. 234–242.
    CrossRef
  24. Amy E. Geddes, X.-F.H., Kelly A. Newell, Reciprocal signaling between NR2 subunits of the NMDA receptor and neuregulin1 and their role in schizophrenia. Progress in Neuro-Psychopharmacology and Biological Psychiatry, 2011. 35(4): p. 896–904.
    CrossRef
  25. C S Weickert, S.J.F., V S Catts, P R Schofield, K M Allen, L T Moore, K A Newell, D Pellen, X-F Huang, S V Catts, T W Weickert, Molecular evidence of N-methyl-d-aspartate receptor hypofunction in schizophrenia. Molecular Psychiatry, 2013: p. 1185–1192.
    CrossRef
  26. Gunduz-Bruce, H., The acute effects of NMDA antagonism: From the rodent to the human brain. Brain Research Reviews, 2009. 60(2): p. 279–286.
    CrossRef
  27. Lars V Kristiansen , I.H., Monica Beneyto, James H Meador-Woodruff NMDA receptors and schizophrenia. Current Opinion in Pharmacology, 2007. 7(1): p. 48–55.
    CrossRef
Visited 1,009 times, 1 visit(s) today
Article Metrics
PlumX PlumX: 
Views Views:  514 Views
PDF Downloads PDF Downloads:  5409

Article Publishing History
Received on: 28 November 2016
Accepted on: 12 December 2016


Share

FOLLOW US ON:

facebook Twitter Mendeley LinkedIn


SEARCH WEBSITE


MEMBER OF

Logo-image


JOURNAL ARCHIVED IN

Logo-image