Prevalence of Hopq Alleles and Relationship Between Caga and Vaca S1 With Hopq I Gene in Helicobacter Pylori Strains Isolated from Patients With Peptic Ulcer Referred to Towhid Hospital in Sanandaj (2014)


Amin Hooshyar Chichaklu1, 2, Manouchehr Ahmadi Hedayati2, 3, Farshad Sheykh Esmaili3, Ebrahim Ghaderi4, and Mohammad Hossein Dareh Shiri1, 2
1Student Research Committee, Kurdistan University of Medical Sciences, Sanandaj, Iran 2Department of Microbiology, Kurdistan University of Medical Sciences, Sanandaj, Iran 3Liver and Digestive Research Center, Kurdistan University of Medical Sciences, Sanandaj, Iran 4Department of Statistics and Epidemiology, Kurdistan University of Medical Sciences, Sanandaj, Iran. Corresponding Author Email: hooshyar.kums@gmail.com

DOI : http://dx.doi.org/10.13005/bbra/2008

Download this article as:  PDF

ABSTRACT:

Infection with H. pylori leads to digestive diseases including gastritis, peptic ulcer, and gastric adenocarcinoma. The virulence factors of H. pylori outer membrane proteins or Hop (Helicobacter pylori outer membrane protein) as an auto transporter and has widely adhesion properties, phase changes and recombination. H. pylori genome is widely encoded HopQ (Helicobacter pylori outer membrane protein Q), which affect the strains of H. pylori binding to human epithelial cells. The aim of this study determine the prevalence of  hopQ alleles and associated Between cagA and vacA s1 with hopQ I gene in H. pylori strains isolated from patients with peptic ulcer referred to Towhid Hospital in Sanandaj (2014). Biopsy specimens from 100 patients with peptic ulcer H. pylori positive were collected and separated, different allele hopQ, vacA, cagA by PCR (Polymerase Chain reaction) was determined. The relationship between genes, cagA and vacA s1 hopQ I with Chi-square test SPSS version 20 (version 19, SPSS Inc., Chicago, IL) was used. P value <0.05 was considered as significant. The frequency of genes hopQ I, hopQ II, cagA, vacA s1, vacA s2, respectively, 54 (54%), 46 (46%), 51 (51%), 83 (83%), 17 (17 %). The relationship between hopQ I and cagA (P<0.01), hopQ I and vacA s1 (P<0.026), respectively. In this study, the presence of the CagA and hopQ I, HopQ I and VacA S1 gene in patients with gastric ulcer statistically significant relationship was found.

KEYWORDS:

Helicobacter pylori; HopQ; Peptic ulcer; outer membrane proteins; Sanandaj

Introduction

Helicobacter pylori is a gram-negative bacterium that persistently colonize the human gastric mucosa (1, 2, 3,  4). Gastric colonization by H. pylori account as a risk factor for the development of peptic ulcer disease and distal gastric adenocarcinoma (5, 6 ,7). The genetic diversity is consistently detected among H. pylori strains isolated from infectious patients and this genetic diversity can helps to account for varying clinical outcomes among persons colonized with H. pylori (8, 9). Candidate markers for distinguishing disease-associated H. pylori strains (i.e., those associated with peptic ulceration or gastric adenocarcinoma) from less virulent strains include presence of the cag pathogenicity island and s1/m1 polymorphisms in vacA alleles (10). Most of studies survey relation of several H. pylori virulence factors simultaneous with clinical diseases (11, 12, 13, 14). In this way, survey of prevalence hops, vacA toxin and secretion.

system type IV (in this case cagA) genes can lead to important findings in associated with clinical outcomes of H. pylori infection (15, 16, 17 and 18).  The outer membrane proteins as H. pylori virulence factors have a high level of genetic diversity (19, 20). Hops (H. pylori outer membrane proteins) such as Bab, Sab, Alp, HopZ and HopQ have difference prevalence in H. pylori strains isolated from difference geographical area and clinical outcomes

(21,22,23,24,25,26,27and 28).hopQ I allele is predominantly associated with presence of cagA in Eastern Asian strains isolated from patients with peptic ulcer and hopQ II allele is predominantly associated with absence of cagA in Western strains isolated from patients (29, 30 and 31). It is noticeable, how is genetical pattern of hopQ alleles in H. pylori strains isolated from Iranian patients as a country between western and eastern countries.  There is high rates of H. pylori infection in Iranian population and increase the number of gastrointestinal complaints led to study whether the presence of the Hop alleles can result in clinical outcomes (29, 30 and 31). As a considerable point, it is shown HopQ as an outer membrane protein lead to decline attachment of H. pylori to gastric epithelial cells that effect on delivery of CagA protein into gastric epithelial cells presumably (32, 33, 34 and 35). In previous studies it shown presence of hopQ alleles is associated with cagA situation (36, 37, 38, 39, 40 and 41). So, determine prevalence of hopQ alleles and cagA together in Iranian strains can support or decline previous studies. The main objective of this study was to evaluate the association between the presence of cagA, vacA and hopQ alleles in H. pylori strains isolated from patients with peptic ulcer using the PCR method.

Materials and Methods

Persons with sadness in the area of ​​the upper gastrointestinal and referred to Tohid Hospital at Sanandaj were objective cases. 100 Gastric biopsy samples were collected from patients with Peptic ulcer and H. pylori positive using Endoscopy. Situation of infection to H. pylori determined with use urea breath test. Information on factors such as age, sex and drugs obtained by questionnaire and were prepared for all forms of morality with peptic ulcer patients. Pathological diagnosis or procedure was performed by a specialist. At least two Gastric biopsies were collected from each patient for test RUT (Rapid urea test) and molecular and pathological study. To investigate the molecular sample taken after the transition to 1.5 microliter tubes containing thioglycollate medium and transfer to Microbiology Lab. in Kurdistan University of Medical Sciences and were stored in a freezer at -80°C for DNA extraction time. For DNA extraction stage, biopsy samples were transferred in sterile conditions and carefully. Then QIAamp DNA Mini Kit (Qiagen) as DNA extraction kit were used for DNA extraction directly from biopsy samples. DNA extraction was performed such as company protocols in catalog. Specific primers were used for hopQ I/II, vacA and cagA as shown in Table 1. The final volume of PCR master mix was 25 ml and was prepared using Master kit (Cinnagen, Iran). Thermal cycling for PCR amplification was optimized as shown in Table 2. PCR products rounded on 2% agarose gel and stained with Sybeer green (Cinnagen, Iran), then observed by UV (Ultraviolet) light. Chi-square test (version 19, SPSS Inc., Chicago, IL) was used for analyses statically.

Table 1: Primer Designer

Gene or Primer designation Primer 5’→3′ Amplimer size(bp) reference
locus
HP1177 hopQ I F ACGAACGCGCAAAAACTTTA 187 Sicinschi et al (2012)
R TTGCCATTCTCATCGGTGTA
HP1177 hopQII F ACAGCCACTCCAATCCAGAA 160 Sicinschi et al (2012)
R AACCCCACCGTGGATTTTAG
cagA cagA F TTGACCAACAACCACAAACCGAAG 183 Sicinschi et al (2012)
R CTTCCCTTAATTGCGAGATTCC
vacA VA1 F ATGGAAATACAACAAACACAC 136 Sicinschi et al (2012)
V136 R CAACAATGGCTGGAATGAT

 

Table 2: Program thermocycler instruments

Temperature and time Steps of PCR technique
35 cycles of:
95° (15 min) First denaturation
95° (1 min) Denaturation
56° (1 min) Annealing
72° (65 sec) Extension
72° (5 min) Final extension

 

Results

The study of 100 Gastric biopsy samples from Iranian patients with Peptic ulcer and H. pylori-positive shown frequency of genes hopQ I, hopQ II, cagA, vacA s1, vacA s2, were 54 (54%), 46 (46%), 51 (51%), 83 (83%), 17 (17 percent) respectively (Table 3). Results of Chi-square test statistically shown a significant correlation between the presence of the hopQ I and cagA genes (P<0.01), hopQ I and vacA s1 genes (P<0.026) and vacA s2 and hopQ II in cagA-negative strains (Table 4).

Table 3: Frequency of hopQ, vacA and cagA Genotypes in Peptic ulcer patient

Genotypes
cagA vacA s2 vacA s1 hopQ II hopQ I Allele
n=51(51%) n=17(17%) n=83(83%) n=46(46) n*=54 (54%) Positive
n=49(49%) n=83(83%) n=17(17%) n=54(54%) n=46(46%) Negative

*(n=100)

Table 4: Relationship between hopQ Alleles and cagA and vacA

Gene or Allele

hopQ Two-sided P* value
hopQ I hopQ II Pearson Chi-Square
cagA Positive 34(66.7%) 17(33.3%) <0.010
Negative 20(40.8%) 29(59.2%)
vacA s1 49(59.0%) 34(41.0%) <0.026
s2 5(29.4%) 12(70.6%)

*𝑃 value of <0.05 was considered as statistically significant

Discussion

Progress by the interaction of several factors in the pathogenesis of H. pylori infection as well as infection by Helicobacter pylori host of superficial inflammation of the stomach and inevitable role in the etiology of peptic ulcer disease show (10, 15, 23 and 38). Access to the successful colonization of the biological concepts for a bacterial adhesion mechanism is complex and bacterial produced the largest share among all products should be made to account for bacterial colonization (1, 2, 3 and 4). The hopQ gene in H. pylori is a major protein of the outer membrane (29, 33). To determine the relationship between HopQ protien and gastrointestinal diseases may be to provide a point to answer questions about the adhesion of the bacteria to the stomach epithelial cells (30, 31 and 36). The study to determine the frequency of genotypes associated hopQ (hopQ alleles with cagA and hopQ alleles with vacA) in H. pylory strains isolated from biopsy samples was designed. It is believed that the analysis based on the genotyping of H. pylori strains isolated from clinical specimens can be useful in prognosis of Infectious Disorders (36, 37 and 41). According to the results of recent studies hopQ I allele correlated significantly with an increased risk of developing Stomach ulcers in Western countries and also hopQ II allele are checked in this population frequently (30). Sicinschi and colleagues in 2012 assessed the frequency of allele’s hopQ, vacA and cagA in H. pylori strains isolated from 86 asymptomatic children. The frequency of allele’s hopQ I and vacA was detected 73.7% and 91.7% respectively (P<0.0001) (36). In 2013, Belogolova and colleagues presented a study on protein secretion system that HopQ protein as a virulence factor associated with CagA protein and the type 4 secretion system of H. pylori and answers related to effect of CagA protein on cell morphology and cell dispersion. According to the results, HopQ protein as a cofactor plays an important role in the type 4 secretion system of H. pylori (34). In our study, the frequency of allele’s hopQ I, vacA and cagA were detected in H. pylori strains isolated from 100 peptic ulcers samples. The relationship between the presence of hopQ I and cagA (p<0.01) and also hopQ I and vacA s1 (p<0.026) was significant statistically. It can because to presence of hopQ gene on genetic area of cagA and vacA virulence genes and simultaneous expression of these genes is developing a stomach ulcer argue. Further studies in this direction would be to identify strategies for physicians and the anti-peptic ulcer disease, gastritis and gastric cancer to improve.

Acknowledgements

The authors wish to thank H. Ghafori, Sh Fakhari, A. ahmadi, R Ramazanzadeh, MB Khademerfan, B Nikkhou, F fathi, A jalili for their kind assistance in this study. This research has been supported by Kurdistan University of Medical Sciences Services grant

References

  1. Rhee KH, Park JS, Cho MJ. Helicobacter pylori: bacterial strategy for incipient stage and persistent colonization in human gastric niches. Yonsei Med J. 2014 Nov;55(6):1453-66.
  2. Odenbreit S. Adherence properties of Helicobacter pylori: impact on pathogenesis and adaptation to the host. Int J Med Microbiol. 2005 Sep;295(5):317-24.
  3. Salama NR, Hartung ML, Müller A. Life in the human stomach: persistence strategies of the bacterial pathogen Helicobacter pylori. Nature Reviews Microbiology. 2013;11(6):385-99.
  4. Amieva MR, El–Omar EM. Host-bacterial interactions in Helicobacter pylori infection. Gastroenterology. 2008;134(1):306-23.
  5. Kusters JG, van Vliet AH, Kuipers EJ. Pathogenesis of Helicobacter pylori infection. Clin Microbiol Rev. 2006 Jul;19(3):449-90.
  6. Blaser MJ, Atherton JC. Helicobacter pylori persistence: biology and disease. Journal of Clinical Investigation.2004.;113(3):32146-49
  7.  Oluwasola AO. Genetic determinants and clinico-pathological outcomes of helicobacter pylori infection. Ann Ib Postgrad Med. 2014 Jun;12(1):22-30.
  8. Gunaletchumy SP, Seevasant I, Tan MH, Croft LJ, Mitchell HM, et al. Helicobacter pylori genetic diversity and gastro-duodenal diseases in Malaysia. Sci Rep. 2014 Dec 11;4:7431. doi: 10.1038/srep07431.
  9.  Chiurillo MA, Moran Y, Cañas M, Valderrama E, Granda N, et al. Genotyping of Helicobacter pylori virulence-associated genes shows high diversity of strains infecting patients in western Venezuela. Int J Infect Dis. 2013 Sep;17(9):e750-6. doi: 10.1016/j.ijid.2013.03.004
  10. Salih BA. The role of the putative virulence markers (cagA and vacA ) of Helicobacter pylori in peptic ulcer disease. Saudi Med J. 2004 Jul;25(7):830-6.
  11. Gatti LL, e Souza EKF, Leite KR, de Souza Bastos EL, Vicentini LR, da Silva LC, et al. cagA vacA alelles and babA2 genotypes of Helicobacter pylori associated with gastric disease in Brazilian adult patients. Diagnostic microbiology and infectious disease. 2005;51(4):231-5
  12. Lu H, Yamaoka Y, Graham DY. Helicobacter pylori virulence factors: facts and fantasies. Current opinion in gastroenterology. 2005;21(6):653-9.
  13. Salari MH, Shirazi MH, Hadaiti MA, Daryani NA. Frequency of Helicobacter pylori vacA genotypes in Iranian patients with gastric and duodenal ulcer. J Infect Public Health. 2009;2(4):204-8. doi: 10.1016/j.jiph.2009.08.004.
  14. Breurec S, Guillard B, Hem S, Papadakos KS, Brisse S, et al. Expansion of European vacA and cagA alleles to East-Asian Helicobacter pylori strains in Cambodia. Infect Genet Evol. 2011 Dec;11(8):1899-905. doi: 10.1016/j.meegid.2011.08.007.
  15. Salehi Z, Jelodar MH, Rassa M, Ahaki M, Mollasalehi H, et al. Helicobacter pylori cagA status and peptic ulcer disease in Iran. Dig Dis Sci. 2009 Mar;54(3):608-13. doi: 10.1007/s10620-008-0378-8.
  16. Cavalcante MQ, Silva CI, Braga-Neto MB, Fialho AB, Nunes Fialho A, et al. Helicobacter pylori vacA and cagA genotypes in patients from northeastern Brazil with upper gastrointestinal diseases. Mem Inst Oswaldo Cruz. 2012 Jun;107(4):561-3.
  17. Matsunari O, Shiota S, Suzuki R, Watada M, Kinjo N, et al. Association between Helicobacter pylori virulence factors and gastroduodenal diseases in Okinawa, Japan. J Clin Microbiol. 2012 Mar;50(3):876-83. doi: 10.1128/JCM.05562-11.
  18. Hedayati MA, Eslami G, Daryani NA. Tip-alpha gene expression of Helicobacter pylori using Real Time RT PCR and association with clinical outcomes. Int.J.Curr.Microbiol.App.Sci .2014: 3(2): 769-775.
  19. Yamaoka Y, Ojo O, Fujimoto S, Odenbreit S, Haas R, et al. Helicobacter pylori outer membrane proteins and gastroduodenal disease. Gut. 2006 Jun;55(6):775-81.
  20. Odenbreit S, Swoboda K, Barwig I, Ruhl S, Borén T, Koletzko S, et al. Outer membrane protein expression profile in Helicobacter pylori clinical isolates. Infection and immunity. 2009;77(9):3782-90.
  21. Dossumbekova A, Prinz C, Mages J, Lang R, Kusters JG, et al. Helicobacter pylori HopH (OipA) and bacterial pathogenicity: genetic and functional genomic analysis of hopH gene polymorphisms. J Infect Dis. 2006 Nov 15;194(10):1346-55.
  22. Alm RA, Bina J, Andrews BM, Doig P, Hancock RE, et al. Comparative genomics of Helicobacter pylori: analysis of the outer membrane protein families. Infect Immun. 2000 Jul;68(7):4155-68.
  23. Armitano RI, Matteo MJ, Goldman C, Wonaga A, Viola LA, et al. Helicobacter pylori heterogeneity in patients with gastritis and peptic ulcer disease. Infect Genet Evol. 2013 Jun;16:377-85. doi: 10.1016/j.meegid.2013.02.024.
  24. Goodwin AC, Weinberger DM, Ford CB, Nelson JC, Snider JD, et al. Expression of the Helicobacter pylori adhesin SabA is controlled via phase variation and the ArsRS signal transduction system. Microbiology. 2008 Aug;154(Pt 8):2231-40. doi: 10.1099/mic.0.2007/016055-0.
  25. Landarani Z, Falsafi T, Mahboubi M, Lameh-Rad B. Immunological detection of 34 KDa outer membrane protein as a functional form of OipA in clinical isolates of Helicobacter pylori. Iran J Microbiol. 2014 Oct;6(5):324-9.
  26. Nell S, Kennemann L, Schwarz S, Josenhans C, Suerbaum S. Dynamics of Lewis b binding and sequence variation of the babA adhesin gene during chronic Helicobacter pylori infection in humans. MBio. 2014 Dec 16;5(6). pii: e02281-14. doi: 10.1128/mBio.02281-14.
  27. de Jonge R, Pot RG, Loffeld RJ, van Vliet AH, Kuipers EJ, Kusters JG. The functional status of the Helicobacter pylori sabB adhesin gene as a putative marker for disease outcome. Helicobacter.2004 Apr;9(2):158-64.
  28. Sheu SM, Sheu BS, Chiang WC, Kao CY, Wu HM, et al. H. pylori clinical isolates have diverse babAB genotype distributions over different topographic sites of stomach with correlation to clinical disease outcomes. BMC Microbiol. 2012 May 30;12:89. doi: 10.1186/1471-2180-12-89.
  29. Cao P, Cover TL. Two different families of hopQ alleles in Helicobacter pylori. J Clin Microbiol. 2002 Dec;40(12):4504-11.
  30. Ohno T, Sugimoto M, Nagashima A, Ogiwara H, Vilaichone RK, Mahachai V, et al. Relationship between Helicobacter pylori hopQ genotype and clinical outcome in Asian and Western populations. Journal of gastroenterology and hepatology. 2009;24(3):462-8.
  31. Cao P, Lee KJ, Blaser MJ, Cover TL. Analysis of hopQ alleles in East Asian and Western strains of Helicobacter pylori. FEMS microbiology letters. 2005;251(1):37-43.
  32. Oleastro M, Ménard A. The Role of Helicobacter pylori Outer Membrane Proteins in Adherence and Pathogenesis. Biology. 2013;2(3):1110-34.
  33. Loh JT, Torres VJ, Scott Algood HM, McClain MS, Cover TL. Helicobacter pylori HopQ outer membrane protein attenuates bacterial adherence to gastric epithelial cells. FEMS microbiology letters. 2008;289(1):53-8.
  34. Belogolova E, Bauer B, Pompaiah M, Asakura H, Brinkman V, Ertl C, et Helicobacter pylori outer membrane protein HopQ identified as a novel T4SS‐associated virulence factor. Cellular Microbiology. 2013
  35. Cover TL. Role of Helicobacter pylori outer membrane proteins in gastroduodenal disease. J Infect Dis. 2006 Nov 15;194(10):1343-5.
  36. Sicinschi LA, Correa P, Bravo LE, Peek RM, Wilson KT, Loh JT, et al. Non‐invasive Genotyping of Helicobacter pylori cagA, vacA, and hopQ from Asymptomatic Children. Helicobacter. 2012;17(2):96-106.
  37. McClain MS, Shaffer CL, Israel DA, Peek RM Jr, Cover TL. Genome sequence analysis of Helicobacter pylori strains associated with gastric ulceration and gastric cancer. BMC Genomics. 2009 Jan 5;10:3. doi: 10.1186/1471-2164-10-3.
  38. Vannarath S, Vilaichone RK, Rasachak B, Mairiang P, Yamaoka Y, et al. Virulence genes of Helicobacter pylori in gastritis, peptic ulcer and gastric cancer in Laos. Asian Pac J Cancer Prev. 2014;15(20):9027-31.
  39. Marie MA. Relationship between Helicobacter pylori virulence genes and clinical outcomes in Saudi patients. J Korean Med Sci. 2012 Feb;27(2):190-3. doi: 10.3346/jkms.2012.27.2.190.
  40. Kim JY, Kim N, Nam RH, Suh JH, Chang H, et al. Association of polymorphisms in virulence factor of Helicobacter pylori and gastroduodenal diseases in South Korea. J Gastroenterol Hepatol. 2014 May;29(5):984-91. doi: 10.1111/jgh.12509.
  41. Romo-González C, Salama NR, Burgeño-Ferreira J, Ponce-Castañeda V, Lazcano-Ponce E, et al. Differences in genome content among Helicobacter pylori isolates from patients with gastritis, duodenal ulcer, or gastric cancer reveal novel disease-associated genes. Infect Immun. 2009 May;77(5):2201-11. doi: 10.1128/IAI.01284-08.
Visited 1,268 times, 1 visit(s) today
Article Metrics
PlumX PlumX: 
Views Views:  347 Views
PDF Downloads PDF Downloads:  1931

Article Publishing History
Received on: 10 January 2016
Accepted on: 20 February 2016


Share

FOLLOW US ON:

facebook Twitter Mendeley LinkedIn


SEARCH WEBSITE


MEMBER OF

Logo-image


JOURNAL ARCHIVED IN

Logo-image