Cloning and Expression of a Novel Gene Encoded Thermostable Archaeal Aldolase Class Ii from Natural Sample


Santi Nurbaiti1, Akhmaloka1*,  Suharti1, 2, Nishia Waya Meray1, 3
1Biochemistry Research Group, Faculty of Mathematics and Natural Sciences, Institute Teknologi Bandung, Jalan Ganesha 10, Bandung, 40132 Indonesia 2faculty of Pharmacy, Universitas 17 Agustus 1945 (UTA’45) Jakarta, Jl. SunterPermai Raya, Sunter Agung Podomoro, Jakarta, Indonesia 3Department of Oil and Gas Processing Technology, Sekolah Tinggi Teknologi Minyakdan Gas, Jl. Soekarno Hatta KM 8, KarangJoang, Balikpapan, Kalimantan Timur, Indonesia  

Download this article as:  PDF

ABSTRACT:

A novel class II Aldolase was isolatedthroughmetagenomic approach from DomasCrater, West Java, Indonesia. Sequenceanalysis of the enzymewas highly homolog to archaealribulose-5-phosphate 4-epimerase from unculturedAcidilobussp.with percent identityof 63%. Homological analysis of the protein shows that the protein sequence contains all conservedmotifs of aldolase class II. The enzyme shows Zn2+ binding, polypeptide binding, and active sites as other aldolase’s. Phylogenetic analysis of the enzyme showed that the enzyme makes a different branch closed to ribulose-5-phosphate 4-epimerase of unculcuredAcidilobus sp. The genewas expressed in E coli as a host, and produced26kDa of protein. Further analysis of the enzymeshowed that the enzyme is thermostable. In addition, the enzymewas purified through Ion Metal Affinity Chromatography and it showed as single band with the homogeneity at around 96%.

KEYWORDS:

Keywords; aldolase; metagenom; thermostable; cloning

Introduction

Aldolases are important enzymes in formation anddeformation of carbon–carbon bond in the cell. Aldolase also have significant role in producing organic chemistry since their accurate stereo chemical control of the reaction 1,2. Aldolase is present in all organisms such as animal, plant tissue, and in most microorganisms. Based on the requirement of bivalent metal cofactor, the enzymes areclassifiedinto two classes. Class I aldolasesdo not require bivalent metal as cofactor but form ketimine Schiff base intermediate with the substrate dihyroxyacetone phosphate3.Class I Aldolases are found in animal and higher plant tissue. Meanwhile class II aldolases require bivalent metal as cofactor. The last enzymes arefound only in prokaryotes and lower eukaryotes4.

Members of enzyme classified as class II aldolases are rhamnulose-1-phosphate aldolase (EC:4.1.2.19), L-fuculose phosphate aldolase (EC:4.1.2.17) 5,6, and L-ribulose- 5-phosphate 4-epimerase (EC:5.1.3.4). The first two enzymes are involved in the third step offucose metabolism. Meanwhile L-ribulose- 5-phosphate 4-epimeraseis involved in the third step of L-arabinose catabolism 7.L-ribulose-5-phosphate 4-epimerase (EC5.1.3.4) is an enzyme which catalyzes the interconversion of ribulose 5-phosphate and xylulose 5-phosphate in the oxidative phase of the pentose phosphate pathway8.

L-ribulose 5-phosphate⇔ D-xylulose 5-phosphate.

The aldolase has molecular mass of 102 kDa and believed to be composed of four identical 25.5 kDa subunits. It belongs to family of isomerases, specifically those racemases and epimerases acting on carbohydrates and derivatives9.

Now days, aldolses are highly used in pharmaceutical industries.One of the limitation of the enzyme to use in industry is the enzyme denatured at high temperature therefore thermostable enzymes are more preferable. Recent studies reported that various thermophilic and hyperthermophilic microbes were isolated from many hot springs at West Java, Indonesia10,11,12. However, to culture the microorganisms from natural habitat tolaboratory is not easy. By this reason, we use metagenomic approach to explore the novel genes from the nature. Recently nine novel DNA polymerase genes of archaea have succesfully been isolated and characterized in our lab based on metagenomic approach13.

In this paper we would like to describe cloning and expression of gene encoded aldolase class II from DomasCrater based onmetagenomic approach.

Material and Methods

Materials

The microbial samples were collected from hot spring water at Domas Crater, TangkubanPerahu, West Java, Indonesia. The hot spring temperature is at around 93 to 95oC andpH around 1 – 2 respectively.

Methods

Sampling Procedure

The sample was taken from the center spring water and kept in sterile plastic container (5 L) and brought to laboratory immediately (about 20 Km). To collect the cell directly from the sample, the hot water was gently filtered through 0.2µm Millipore filter membrane. The pellet cells on the filters wereput into sterile Erlenmeyer flask containing 100 mL of physiological solution (NaCl 0.9%). The pellet cells were re-suspended in physiological solution with gently shaking of the flask and scrubbing aseptically the filters membrane surface using ose needle. The microbial cellswere then pelleted by centrifugation at 6000 g for 10 min. The pellet was then stored at -20oC until DNA extracted.

Total Community DNA extraction

Total DNA samples were isolated based on Zhou method14with slight modification13. Pellet cell were mixed with 600 µL DNA extraction buffer (100 mMtris-Cl pH 8, 100 mM EDTA pH 8, 100 mM sodium phosphate pH 8, 1.5 M NaCl , 1 % CTAB). The mixture was added 30 µL proteinase K 10 mg/mL and 1 g of sterile sea sand in 2 mL micro tube and shaken at 37oC 150 rpm for 30 min in shaker incubator. After the treatment, 60 µL of SDS 10 % was added and then incubated at 60oC for 2 h with gentle shaking. The mixture was pelleted with centrifugation at 6000 g for 10 min. The supernatant wascollected in new sterile 1.5 mL tube at room temperature. Supernatant was added with an equal volume of chloroform:isoamyl alcohol (24 : 1) v/v solution and shaken well,then centrifuged at 6000 g for 10 min. The aqueous phasewastransferred into new sterile 1.5 mL tube, and then added 0.6 volume of isopropanolwith gentle shaking and then incubated at room temperature for an hour. The pellet was sedimented by centrifugation at 12000 g for 30 minutes at room temperature. The pellet was washed with 70% cold ethanol and then re-suspended with sterile ddH2O to give final volume of 50 µL.

Preparation of Primers and PCR

A pair of primers (FE: GTAGCCATAGACGTGGAGGTCRE: GCCTCTCTAAGTCTTGAAGAACG)were used to amplify the genes randomly from the sample. PCR reaction was performed by using S so fast super mix, (BioRad). 20 µL of PCR reaction (10μL of S so fast, 2 pmolof primer pair, 1 µL of community DNA as template and ddH2O) wa sused for the amplification. PCR process was carried out into five steps. There arean initial denaturation step at temperature of 98oC for 3 min.Each cycle of denaturation at 98oC 30s, for 31 cycles annealing temperature with gradient temperature from 56°C to 46°C for 30s.Extension reaction at 72°C for 3 min and final extension at 72°Cfor 10 min and cooling at 12oC for 10 min.

Cloning and Sequencing

pJET12/blunt cloning kit (Fermentas) was used for cloning of PCR product. The ligation reaction was carried out according to the kit manual. The ligation product was then used to transform E coli Top10 (Invitrogen).

DNA sequencing was performed by using the Dye Terminator (3′-dye labeled dideoxynucleotide triphosphate) including several stages, namely: template preparation, sequencing reaction, PCR product purification, electrophoresis and scanning fluorescence.

Homological analysis

Nucleotide homological analysis were performed by aligning the DNA sequences with NCBI data using BLASTN program15. Prior to the homology analysis, the sequences ware exposed to ORF finder for determining the coding region. The coding region was translated in silico based on BLASTP program. Alignment of amino acid sequences was performed by ClustalX program and visualized using genedoc program. Phylogenetic tree was constructed based on maximum like hood method using Jones-Taylor-Thornton (JTT) model with Mega516

Heterologous expression

Two primers based on the nucleotide sequence of the aldolase gene were synthesized to isolate the whole aldolase gene to be expressed. The sequence of N terminal primer FEx 5’CGCGGATCCTTGAGGCTCAATGAGAG3’ contain a unique BamHI site and the C terminal primer sequence is REx5’ACGGTCGACCCGATAGAACACACCC3’ that contain a unique SalI site.The 50 µL of PCR mix is  contain 5 µL of DNA template, 3 µL 2,5 mM of each primer, 5 µL of dNTP mix 2 mM, 5 µL of PCR buffer 10X (500 mM KCl, 100 mM Tris-HCl pH 8) 4 µL of MgCl2 2 mM, 1 U ofTaqPol I and added ddH2O until 50 µL. The PCR reaction consisted of 30 cycles of 94oC for denaturing, 1 min, 46oC for annealing, 1 min and 72oCfor elongation, 3 min, initial denaturing at 94oC for 3 min and final elongation for 10 min at 72oC. The amplified fragment containing the whole aldolase gene was ligated to pGEM using pGEMT easy kit, then transformed to E. coli TOP 10,and cloned. The plasmid containing the whole aldolase gene then digested with BamHI and SalI, and then purified from 0.8% low melting agarose gel and then ligated into the expression vector pET-30a (Novagen, USA), which had digested with the same enzymes.

Recombinant expression plasmids were transformed into E. coliBL21(DE3) cells and over expression of the aldolase gene was induced by the addition of isopropyl-β-D-thiogalactopyranoside (IPTG) at the mid-exponential growth phase (OD600= 0.6), followed by 4 h incubation at 37oC. The cells were harvested by centrifugation (6000 g at 4oC for 30 min) and re-suspended in 10 mMTris–HCl buffer pH 7.0. The cells were disrupted by sonication and the crude protein sample was treated at 60oC for 30 min after centrifugation (16,000 g at 4oC for 15 min). The resulting supernatant was then applied to a once step purification through Ion Metal Affinity Chromatography through Ni-NTA resin. The column was washed and bound proteins were eluted with Tris-HCl buffer pH 7.0 containing 250 mMNaCl and an imidazole gradient (20-250 mM). Protein concentration was determined usingBradford method (1976) with bovine serum albumin (BSA) as standard. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed with 12% polyacrylamide gel, as described by Laemmli (1970)17.

Result

Amplicon of aldolase fragment

A total DNA from the nature was used to amplify the gene. PCR was performed by using FE (5’GTAGCCATAGACGTGGAGGTC3’) and RE (5’GCCTCTCTAAGTCTTGAAGAACG3’) primers. The PCR product at around 2 kb was appeared on agarose gel (Fig. 1). Following insertion of amplicon into pJET blunt vector, the whole fragment was sequenced and analyzed. The result showed that the amplicon contains 0.6 kb of ORF aldolase class II gene. The whole sequence of aldolasea class II gene was submitted to the gene bank with ID number of KP893071.

Homology of the gene

The whole sequence of aldolase class II gene was in silico translated. The amino acid sequence was aligned to the NCBI data base. The result showed that the sequence is closely homolog to aldolase of Crenarchaea phyla with best homology to ribulosa-5-phosphate 4-epimerase from uncultured Acidilobus sp.  with percent identity of 63% (Fig. 2). Detail analysis by comparing the sequence of 15 best homology showed that the sequence contains most of conservative motifs of aldolase class II, (Fig. 3), with the enzyme active sites at N21, T36, G37, S66, S67, E68, H87, H89 and H152.In addition, the protein also contains Zn2+ binding sites at H87, H89 and H152. These data were supported by the report ofMarchler-Bauer18. From all at the above data suggested that the protein is belong to aldolase class II family.Further analysis by constructing phylogenetic tree among 19 other best homolog at aldolases showed that the protein clustered to ribulose-5-phosphate 4-epimerase of Acidilobussp, however the protein appears in difference branch (Fig. 4). This suggests that the protein is a novel aldolase class II.

Expression and purification of aldolase

Aldolase gene on plasmid pJET blunt was amplified by PCR usingFEx and REx primers to create BamHI and SalI restriction site on the gene. 0.6 kb of the amplicon carrying BamHI and SalI restriction site was inserted on expression vector pET30a(+) at the sites. The recombinant pET30a (pITB-aldII) was transformed to E. coli BL21(DE3). Recombinant aldolase gene was expressed in E. coliBL21(DE3) at 37oC following induction of IPTG. The product of recombinant protein was present in the soluble fraction after centrifugation of crude extract. The protein was appeared as a bulky protein band on the SDS-PAGE with the size around 26 kDa (Fig. 5). Densitometer analysis showed that the homogeneity of the protein is around 42%.Further analysis to probe thermostability of the protein by incubating the crude extract at 60oC for 30 min showed that the protein was still intact following the treatment (Fig. 5). Since the recombinant protein carrying N-terminal His-tag, the protein was purified through IMAC by using Ni-NTA resin. SDS-PAGE following purification showed a single protein band corresponding to 26 kDa (Fig. 6) with homogeneity at around 96 %.

References

  1. Wong CH, Whitesides GM. Enzymes in synthetic organic chemistry. Elsevier; Oxford: 1994; pp. 215–228.
  2. Fessner WD. Enzyme mediated C–C bond formation. CurrOpinChemBiol.,1998; 2:85-97
  3. Grazi, E., Rowley, P.T., Chang, T., Tchola, O. and Horecker, B.L. The mechanisms of action of aldolases III: Schiff base formation with lysine. BiochemBiophys Res Commun.,1962;9: 38-43.
  4. Gefflaut T, Blonski C, Perie J, Willson M. Class I aldolases: Substrate specificity, mechanism, inhibitors and structural aspects. ProgBiophysMol Biol.,1995; 63:301-340.
  5. Dreyer MK, Schulz GE.The spatial structure of the class II L-fuculose-1-phosphate aldolase from Escherichia coli.J Mol Biol., 1993; 231(3):549-53.
  6. Samuel, Jomy; Yu Luo; Paul M Morgan; Natalie CJ Strynadka; Martin E Tanner.”Catalysis and binding in L-Ribulose 5-Phosphate 4-Epimerase: A Comparison with L-Fuculose Phosphate Aldolase”. Biochemistry,2001; 40 (49): 14772–14780
  7. Dreyer MK, Schulz GE. Catalytic mechanism of the metal-dependent fuculose aldolase from Escherichia coli as derived from the structure.J Mol Biol., 1996;259(3):458-66.
  8. Englesberg, E.; R.L. Anderson, R. Weinberg.”L-Arabinose-Sensitive, L-Ribulose 5-phosphate 4-Epimerase-Deficient Mutants of Escherichia coli“. Journal of Bacteriology, 1962; 84 (137).
  9. Luo, Yu; Jomy Samuel; Steven C Mosimann; Jeffrey E Lee; Martin E Tanner; Natalie CJ Strynadka (). “The Structure of Ribulose-5-Phosphate 4-Epimerase: An Aldolase-like Platform for Epimerization”. Biochemistry, 2001; 40: 14763–14771.
  10. Indrajaya, Warganegara FM and Akhmaloka.Isolation and Identification of ThermophilicMicroorganismsfromWayangCrater. JurnalMikrobiologi Indonesia,2003; 8:53-56.
  11. Akhmaloka, Suharto A, Nurbaiti S, Tika IN, andWarganegara FM.Ribotyping Identification of Thermophilic Bacterium from Papandayan Crater.Proc. ITB Eng. Science,;2006; 38b (1): 1-10.
  12. Yohandini H, Madayanti F, Aditiawati P and Akhmaloka. Diversity of microbial thermophilesin a neutral hot spring (KawahHujan A) of Kamojang geothermal field, Indonesia. J. Pure and ApplMicrobiol., 2008; 2(2): 283-293.
  13. Suhartia SS, Hertadia R, Warganegaraa FM, Nurbaitia S, Akhmaloka.Diversity of gene encoded crenarchaeal DNA polymerase B from natural sample Int. J. Integ. Biol., 2014; 15(2):  44-48
  14. Zhou J, Bruns MA and Tiedje JM. DNA Recovery from Soils of diverse composition. App. Environ Microbiol., 1996; 62: 316–322.
  15. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, dan D. J. Lipman. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res.,1997; 25(17), 3389-3402.
  16. Hall BG. Building Phylogenetic Trees from Molecular Data with MEGA.MolBiolEvol., 2013; 30(5): 1229-1235.
  17. Sambrook, J., E. F. Fritsch, dan T. Maniatis. Molecular cloning: a laboratory manual, 2nd ed, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.1989.
  18. Marchler-Bauer A, Derbyshire MK, Gonzales NR, Lu S, Chitsaz F, Geer LY, Geer RC, He J, Gwadz M, Hurwitz DI, Lanczycki CJ, Lu F, Marchler GH, Song JS, Thanki N, Wang Z, Yamashita RA, Zhang D, Zheng C, Bryant SH. CDD: NCBI’s conserved domain database.Nucleic Acids Res., 2015; D222-6
Visited 706 times, 1 visit(s) today

Share

FOLLOW US ON:

facebook Twitter Mendeley LinkedIn


SEARCH WEBSITE


MEMBER OF

Logo-image


JOURNAL ARCHIVED IN

Logo-image