Investigating the Antibacterial Properties of Silver Nanoparticles Acquired using Streptomyces strain AK3 from Riverbank Soil 


Arun Kumar Kulshrestha* and Priti Hemant Patel

Department of Biotechnology, Ganpat University, Gujarat, India.

Corresponding Author E-mail: arunmonty368@gmail.com

DOI : http://dx.doi.org/10.13005/bbra/3094

Download this article as:  PDF

ABSTRACT:

The soil sample was acquired from a heavily metal polluted site on the Tapi River in Surat, Gujarat, India, diluted serially, and dispersed over an actinomycetes isolation medium. Isolates were cultured in 100 ml of starch-casein broth at 300 C for 72 hours in an incubator with shaking. The cell-free filtrate was added to a final solution of 1 mM silver nitrate, which was then dried at 250C. Using a spectrophotometer, silver nanoparticles were quantified, data on size distribution and zeta potential were acquired from Malvern, and the 16S rRNA gene was amplified in a PCR mixture. As a result of the addition of silver nitrate to the S. atacamensis strain AK3 filtrate, the reducers altered the broth's color from yellow to light brown. The highest absorbance was measured at 420 nm, and the 0.25 polydispersity index was below the agglomeration threshold. The TEM indicated their spherical to ellipsoidal shape and 20 nm size. The NJ approach to sequence alignment revealed that the strain was 99.42% similar to S. atacamensis C60. Zones of inhibition of S. epidermidis, A. baumanni, N. gonorrhoeae, and L. monocytogenes were found to be 18±1 mm, 19±1 mm, 20±1 mm, and 14±1 mm respectively, at 35 μg/ml AgNPs, proving the efficiency of AgNPs synthesized by the strain.

KEYWORDS:

Antibacterial activity; Silver nanoparticles; TEM; UV-Vis spectra; Zeta potential

Introduction

At various times, one or more medications were administered to the pathogenic bacterial species. Due to the natural selection of resistant strains each time, none of these therapies were very effective; hence, the scientific community is using a variety of strategies to address this problem 1-4. Due to their unique physical features, nanoparticles have been considered as a potential agent against pathogenic microorganisms 5,6. Compared to gold, zinc, iron, etc., silver nanoparticles demonstrate greater efficiency 7. Nanoparticles of silver smaller than 10 nm exhibit deleterious effects on human cells 8,9. By altering the procedure temperature, the size of the silver nanoparticles may be modified. This is because silver nanoparticles are stable at high temperatures and the nucleation rate constant varies with temperature 10. Optimizing the concentration of silver nanoparticles will limit their electrical conductivity and prevent the formation of big crystals 11,12. Biosynthesized silver nanoparticles have more clinically effective uses than chemically produced ones. Moreover, hazardous substances may be absorbed by silver nanoparticles during chemical production 13,14. Silver nanoparticles synthesised by actinomycetes are both mild on human cells and inexpensive to produce 15-17. The optimal conditions for the biosynthesis of silver nanoparticles should be determined using statistical models 18. Actinomycetes are dual-natured, soil-dwelling bacteria that exhibit traits of both bacteria and fungus 19-21. Work has been done on the ability of actinomycetes to make secondary metabolites that can be used to treat patients 22,23. The fabrication of silver nanoparticles by Streptomyces inhabiting industrially polluted areas, as well as their therapeutic applications, has rarely been described 24,25. Biosynthesis of silver nanoparticles by Streptomyces inhabiting an industrially contaminated location; Tapi river, Surat, Gujarat; and their medical uses in humans are the focus of this work.

Materials and Methods

Soil collection and isolation of actinomycetes

The soil sample was obtained from the heavy metal contaminated location on the Tapi river in Surat, Gujarat, India, diluted serially, and disseminated over actinomycetes isolation medium (HI media M490) enriched with 25 μg/ml cycloheximide, 50 μg nystatin, and 25 μg nalidixic acid. The pH of the media was set at 6.9 26,27. After 1.5 weeks of incubation at 300 C, actinomycetes had successfully developed. Isolates were stored in 50% (V/V) glycerol at -400 C and sub-cultured for later use.

Silver nanoparticles synthesizing ability-based selection of isolate

The isolates were grown in 100 ml of Starch casein broth (SCB), (S7968-25B Molecular grade) at 300C for 72 hours in the shaking incubator so that mycelia can clump as several small balls. Each SCB was filtered with a bacteriological filter and washed with distilled water to remove any impurities then, a 10-gm wet cluster of actinomycetes was suspended in 100 ml distilled water followed by shaken incubation at 300C for 72 hours. Mycelia in distilled water were centrifuged, and the cell-free filtrate was added to a final solution of 1 mM silver nitrate (RANKEM AR) and 0.5 mM sulphur-containing amino acid 28. The color of the added cell-free filtrate turned pale brown on the third day of incubation, and then the cell-free filtrate was heated at 2500C to dry. This dried substance containing nanoparticles of silver was thoroughly combined with 100 ml of distillated water 29.

The growth of isolates and production of AgNPs are briefly shown in the flowchart below.
Soil samples → Serial dilution → Spreading over the actinomycetes isolation media supplemented with 25 μg/ml of cycloheximide, 50 μg/ml of nystatin, and 25 μg/ml of nalidixic acid → Isolates transferred to Starch casein broth → Filtration of SCB → Suspension of cell filtrates in distilled water → Centrifugation → Addition of AgNO3 to cell free filtrates → Incubation → Colour observation

Quantification and structural properties of synthesized silver nanoparticles

The quantification of silver nanoparticles was done with the spectrophotometer [UV-VIS 1700, Range- (190nm-1100nm), Wavelength accuracy- ±0.3, and Shimadzu made]. The size distribution and the zeta potential reports were obtained using Malvern. The Characterization of silver nanoparticles was accomplished with Transmission electron microscope (Accelerating voltage- 80 to 200 kV, Joel.).

16S rRNA gene sequencing of actinomycetes isolate

The 16S rRNA gene was amplified in 100μl PCR mixture [54.3ng DNA, 0.5mM of each dNTP, 400ng of each primer  (5`GGATGAGCCCGCGGCCTA3` and 5`CGGTGTGTACAAGGCCCGGGAAC3`), 3.2mM MgCl2, and 1μl 3U Taq DNA polymerase]. In the PCR machine, the amplification was accelerated for 30 cycles and two hours. Each cycle lasted one minute for denature, one minute for anneal, and two minutes for extension. The amplified DNA was sequenced using an ABI3130 genetic analyser, sequence homology was determined using BLAST, and a phylogenetic tree was constructed using the bootstrap 30.

Treatment of human pathogens with various concentrations of Silver nanoparticles

At doses of 7 mcg/ml, 8 mcg/ml, 9 mcg/ml, 10 mcg/ml, 11 mcg/ml, and 12 mcg/ml, silver nanoparticles were examined for Neisseria gonorrhoeae ATCC49226 and Acinetobacter baumannii ATCC19606. AgNPs concentrations of 10 mcg/ml, 15 mcg/ml, 20 mcg/ml, 25 mcg/ml, 30 mcg/ml, 35 mcg/ml, and 40 mcg/ml were used to treat Listeria monocytogenes ATCC13932 and Staphylococcus epidermidis ATCC12228.

Results

Selection of actinomycetes isolate for synthesis of the silver nanoparticles

After 48 hours, the addition of silver nitrate to the cell free-filtrate caused the reducers of Streptomyces atacamensis strain AK3 to change the colour of the broth from yellow to pale brown. UV-VIS spectrophotometer, Zeta sizer, and TEM were used to examine the characteristics of silver nanoparticles. The maximum absorption was recorded at 420nm, confirming the presence of silver nanoparticles shown in Figure 1.

Figure 1: UV-Vis spectra of sample containing AgNPs

Click here to view figure

It was observed that the 0.25 polydispersity index (PDI) was lower than the agglomeration value. The zeta potential of silver nanoparticles was determined to be -14 mV, indicating the slight aggregation of silver nanoparticles as shown in Figure 2. 

Figure 2: Zeta potential of silver nanoparticles.

Click here to view figure

The TEM micrograph of silver nanoparticles revealed their spherical to ellipsoidal form and 20 nm size as shown in Figure 3.

Figure 3: TEM images of obtained AgNPs.

Click here to view figure

Morphological and molecular identification of the actinomycetes isolate

The colonies were wrinkly, slightly curved, and resembled chalk, and the strain thrived in aerobic conditions at 320C. The 16s rRNA gene was used to molecularly identify the strain. Sequencing developed an image of a 1040 bp-long gene for research. The NJ technique of sequence alignment discovered that the strain is 99.42% identical to S. atacamensis C60. The 16s rRNA gene sequencing data for this strain is accessible from the NCBI gene bank with the accession number MT626067. Figure 4 depicts the band of 16S rRNA gene of the strain. 

Figure 4: Band of strain’s rRNA gene

Click here to view figure

A comparative analysis of strain-produced AgNPs and widely recognized antibiotics

As indicated in Table No. 1 and Figure 5, in a comparison of the efficacy of synthesized silver nanoparticles and antibiotics against some human microbiological diseases, synthesized silver nanoparticles delivered the expected results. 

Table 1: Resistance (R) and sensitivity (S) with zone of inhibition of selected human pathogens to varied quantities of fabricated silver nanoparticles and antibiotics.

S.No.

Antibacterial agent name

Antib-

acterial

agent con.

S. epider-midis

A. baumannii

N. Gonorrhoeae

L. mono-

cytogenes

1

Synthesized AgNPs (A)

10 μg

         R

S (17±2 mm)

S (15±1 mm)

R

2

Synthesized AgNPs (B)

35 μg

S (18±1 mm)

S (19±1 mm)

S (20±1 mm)

S (14±1 mm)

3

Ampicillin

10 μg

R

R

S (18±2 mm)

R

4

Cefotaxime

30 μg

R

S (18±0.6 mm)

S (18±1 mm)

R

5

Cefoxitin

30 μg

R

R

R

R

6

Chloramphenicol

30 μg

R

R

R

R

7

Gentamycin

10 μg

S (14±1 mm)

R

S (19±0.8 mm)

R

8

Levofloxacin

05 μg

S (11±1 mm)

R

R

R

9

Control

R

R

R

R

 

Figure 5: (A) S. epidermidis, (B) A. baumannii, (C) N. gonorrhoeae, (D) L. monocytogenes with zones of inhibition created by AgNPs A, AgNPs B, Ampicillin, Cefotaxime, Cefoxitin, Chloramphenicol, Gentamycin, Levofloxacin, and Control.

Click here to view figure

The relative effects of different silver nanoparticle concentrations on N. gonorrhoeae, A. baumannii, L. monocytogenes, and S. epidermidis are as follows:

Figure 6: Effects of various concentrations of N. gonorrhoeae and  A. baumannii

Click here to view figure

 

Figure 7: Effects of various concentrations of AgNPs on S. epidermidis and L. monocytogens

Click here to view figure

With data fetched from Figures 6 & 7, Regression, P value, ANOVA, and Coefficient of determination as shown in Table-2 incline to use the optimum concentration of AgNPs .

Table 2: Regression, P value, ANOVA, and Coefficient of Determination.

 

Pathogen

Regression

P value

F

R2

1

S. epidermidis

Y = 5.5 + 0.28X

˂ 0.001

64.02

0.9

2

L. monocytogenes

Y = 5.4 + 0.2X

˂ 0.001

62.12

0.9

3

N. gonorrhoeae

Y = 7.40 + 0.38X

˂ 0.001

50.28

0.88

4

A. baumannii

Y = 8.74 + 0.36X

˂ 0.002

24.46

0.78

Discussion 

The physical and chemical processes used to create silver nanoparticles are ecologically toxic and expensive. In the last decade, microorganisms have been harnessed extensively in the fabrication of silver nanoparticles 31,33. The production medium for the biogenesis of silver nanoparticles may be optimised to reduce production costs, with temperature, pH, and AgNO3 concentration serving as three of its most important parameters 34. Compared to typical biomolecules, silver nanoparticles are much more resistant to harsh manufacturing circumstances 35. Actinomycetes are gaining prominence as sources for the synthesis of AgNPs, and this is the first report on the synthesis of AgNPs using S. atacamensis living in the industrially contaminated Tapti river bank for the treatment of selected human diseases in the present study 36,37. Surface area, shape, and size of silver nanoparticles are adjustable with media-involved variables and play a crucial function in defining the level of AgNPs’ efficiency 38. As the thickness of bacterial peptidoglycan grows, the effectiveness of AgNPs diminishes 39. N. gonorrhoeae and A. baumannii were shown to be more susceptible to the synthesised silver nanoparticles than S. epidermidis and L. monocytogenes in the present research. The acceleration of diameter of inhibitory zones grew for optimal concentrations of silver nanoparticles, then decreased at greater concentrations, with the increased concentration of AgNPs inducing agglomeration later. When silver nanoparticles get into a bacterial cell, they cause ROs to be made, which damage the chromatin  40,41. In contrast to the previous work, the cell-free filtrate on the addition of silver nitrate was found to have the potential to synthesise silver nanoparticles. AgNPs were chosen above TiO2, ZnO, Fe3O4, Au, CuO, MgO, NO, and Al2O3 because they have the requisite chemical and physical properties to battle germs 42,43.

Conclusion 

The synthesis of silver nanoparticles using actinomycetes has been documented; however, this work opens the door for silver nanoparticle synthesis by utilizing a strain of Streptomyces sp. isolated from the soil of the Tapi riverbank. The zones of inhibition against human pathogens formed by increasing the concentration of silver nanoparticles did not produce a consistently linear graph, as the acceleration of effectiveness decreased after a particular discrete point, indicating the use of an optimum concentration of AgNPs. This work’s strain AK3 combats the challenges of producing silver nanoparticles in an environmentally hazardous manner, antibiotic side effects, and multidrug-resistant human pathogens.

Acknowledgment

Ganpat university, Mehsana. PERD, Ahmedabad. Bio kart, Bengaluru.

Conflict of Interest 

The authors declare that there is no conflict of interest.

Funding Sources

There are no funding sources.

References

  1. Baptista PV, McCusker MP, Carvalho A, et al. Nano-Strategies to Fight Multidrug Resistant Bacteria-“A Battle of the Titans”. Front Microbiol 2018; 9:
    CrossRef
  2. Ruddaraju LK, Pammi SVN, Guntukuc GS, et. al. A review on anti-bacterials to combat resistance: From ancient era of plants and metals to present and future perspectives of green nano technological combinations. Asian J Pharm 2020; 15(1): 42-59.
    CrossRef
  3. Sekatawa K, Byarugaba DK, Kato CD, et al.Nanotechnological solutions for controlling transmission and emergence of antimicrobial-resistant bacteria, future prospects, and challenges . J Nanopart Res 2020; 22, 117.
    CrossRef
  4. Mozafari MR, Torkaman S, Karamouzian FM, Rasti B and Bara Bl. Antimicrobial Applications of Nanoliposome Encapsulated Silver Nanoparticles: A Potential Strategy to Overcome Bacterial Resistance. Cur Nanosci 2021; 17(1) . https://doi.org/10.2174/1573413716999200712184148
    CrossRef
  5. Khan I, Saeed K, Khan I. Nanoparticles: Properties, applications and toxicities, Arab J Chem 2019; 12(7):908-931. https://doi.org/10.1016/j.arabjc.2017.05.011
    CrossRef
  6. Melo APZ de. Antibacterial activity, morphology, and physicochemical stability of biosynthesized silver nanoparticles using thyme (Thymus vulgaris) essential oil. Mater Res Express 2020; 7(1): 015087.
    CrossRef
  7. Deene M, Lingappa K. Synthesis of silver nanoparticles using the Streptomyces coelicolor klmp33 pigment: An antimicrobial agent against extended-spectrum beta-lactamase (ESBL) producing Escherichia coli. Mater Sci Eng C 2014; 45: 434-437.
    CrossRef
  8. Liao C, Li Y, Tjong SC. Bactericidal and Cytotoxic Properties of Silver Nanoparticles. Int J Mol Sci 2019; 20(2): 449.
    CrossRef
  9. Ferdous Z, Nemmar A. Health Impact of Silver Nanoparticles: A Review of the Biodistribution and Toxicity Following Various Routes of Exposure. Int J Mol Sci 2020; 21(7): 2375.
    CrossRef
  10. Liu H, Zhang H, Wang J, Wei J. Effect of temperature on the size of biosynthesized silver nanoparticle: Deep insight into microscopic kinetics analysis. Arab J Chem 2020; 13(1): 1011-1019.
    CrossRef
  11. Diantoro M, Suprayogi T, Sa’adah U, Mufti N, Fuad A, Hidayat A, et al. Modification of Electrical Properties of Silver Nanoparticle. Silver Nanoparticles – Fabrication, Characterization and Applications 2018. https://doi.org/10.5772/intechopen.75682.
    CrossRef
  12. Chen D, Chen J. Synthesis and electrical properties of uniform silver nanoparticles for electronic applications. J Mater Sci 2009; 44(4): 1076-1081. 
    CrossRef
  13. Prabhu S, Poulose EK. Silver nanoparticles: mechanism of antimicrobial action, synthesis, medical applications, and toxicity effects. Int Nano Lett2 2012; 32. https://doi.org/10.1186/2228-5326-2-32
    CrossRef
  14. Firdhouse MJ, Lalitha P. Biosynthesis of Silver Nanoparticles and Its Applications. J Nanotechnol 2015; Article ID 829526.
    CrossRef
  15. Kumari S, Tehri N, Gahlaut A, Hooda V. Actinomycetes mediated synthesis, characterization, and applications of metallic nanoparticles, Inorg Nano-Met Chem 2020; doi:1080/24701556. 2020.1835978.
    CrossRef
  16. Al-Dhabi NA, Ghilan A-KM, Arasu MV. Characterization of Silver Nanomaterials Derived from Marine Streptomyces sp. Al-Dhabi-87 and Its In Vitro Application against Multidrug Resistant and Extended-Spectrum Beta-Lactamase Clinical Pathogens. Nanomaterials. 2018; 8(5): 279.
    CrossRef
  17. Adiguzel AO, Adiguzel SK, et al. Silver nanoparticle biosynthesis from newly isolated streptomyces genus from soil. Mater Res Express 2018; 5(4): 045402.
    CrossRef
  18. Naser Y, et. al. Statistical Evaluation of the Pertinent Parameters in Biosynthesis of Ag/MWf-CNT Composites Using Plackett-Burman Design and Response Surface Methodology. Iran J Chem Eng 2016; 35: 2.
  19. Shivabai C, Gutte S. Isolation of actinomycetes from soil sample using different pretreatment methods and its comparative study. Int j res anal rev2019; 6(2): 697-702.
  20. Kumar N, et al. Isolation and screening of soil Actinomycetes as source of antibiotics active against bacteria. Int J Microbiol Res 2010; 2(2): 12-16.
    CrossRef
  21. Pepper IL, Gerba CP, Gentry TJ, Maier RM. Environmental Microbiology. Academic Press; 2011.
  22. Selim MSM, al. Secondary metabolites and biodiversity of actinomycetes. J Genet Eng Biotechnol 2021; 19:72. https://doi.org/10.1186/s43141-021-00156-9
    CrossRef
  23. Abdel-Aziz MS,al. Molecular identification of actinomycetes with antimicrobial, antioxidant and anticancer properties. Comun Sci 2019; 10(2): 218-231. https://doi.org/10.14295/cs.v10i2.2269
    CrossRef
  24. Abdeen S, et. al. Biosynthesis of silver nanoparticles from actinomycetes for therapeutic applications. Int J Nano Dimens 2014; 5(2): 155-162.
    CrossRef
  25. Sukanya MK, et. al. Therapeutic potential of biologically reduced silver nanoparticles from actinomycete culture. J Nanosci 2013; Article ID 940719. 
    CrossRef
  26. Subramani R, Sipkema D. Marine Rare Actinomycetes: A Promising Source of Structurally Diverse and Unique Novel Natural Products. Mar Drugs 2019;17(5):249.
    CrossRef
  27. Sivalingam P, et. Extreme Environment Streptomyces: Potential Sources for New Antibacterial and Anticancer Drug Leads?  Int. J. Microbiol 2019; Article ID 5283948. 
    CrossRef
  28. Saravana Kumar P, Balachandran C, Duraipandiyan V. et. al. Extracellular biosynthesis of silver nanoparticle using Streptomyces 09 PBT 005 and its antibacterial and cytotoxic properties. Appl Nanosci5. 2015; 169–180 . https://doi.org/10.1007/s13204-014-0304-7
    CrossRef
  29. Guilger-Casagrande M, Lima R. Synthesis of silver nanoparticles mediated by fungi: a review. Front. Bioeng. Biotechnol. 2019;7:287. https://doi.org/10.3389/fbioe.2019.0028
    CrossRef
  30. Bruno WJ, Socci ND, Halpern Weighted neighbor joining: a likelihood-based approach to distance-based phylogeny reconstruction. Mol Biol Evol 2000; 17(1): 189-197.
    CrossRef
  31. Li X, Xu H, Chen Z-S, Chen G. Biosynthesis of nanoparticles by microorganisms and their applications. J Nanomater 2011; Article ID 270974: 16 pages. http://doi.org/10.1155/2011/270974
    CrossRef
  32. Mouratao A, Gadanho M, Lino AR, Tenreiro R. Biosynthesis of crystalline silver and gold nanoparticles by extremophilic yeasts. Bioinorg Chem Appl 2011; Article ID 546074: 8 pages. http://doi.org/10.1155/2011/546074
    CrossRef
  33. Guilger-Casagrande M, Germano-Costa T, Pasquoto-Stigliani T,et al. Biosynthesis of silver nanoparticles employing Trichoderma harzianum with enzymatic stimulation for the control of Sclerotinia sclerotiorum. Sci Rep 9. 2019; 14351. https://doi.org/10.1038/s41598-019-50871-0
    CrossRef 
  34. Rose G, Soni R, Rishi P, Soni S. Optimization of the biological synthesis of silver nanoparticles using Penicillium oxalicum GRS-1 and their antimicrobial effects against common food-borne pathogens. Green Process Synth 2019;8(1): 144-156. https://doi.org/10.1515/gps-2018-0042
    CrossRef
  35. Lee S, Phelan PE, Taylor RA, Prasher R, Dai L. Low-Temperature Melting of Silver Nanoparticles in Subcooled and Saturated Water.J Heat Transfer 2016; 138(5): 052301.  https://doi.org/10.1115/1.4032310
    CrossRef
  36. Manimaran M, Kannabiran Actinomycetes-mediated biogenic synthesis of metal and metal oxide nanoparticles: progress and challenges. Lett Appl Microbiol 2017; 64: 401-408. https://doi.org/10.1111/lam.12730
    CrossRef
  37. Abd-Elnaby HM, Abo-Elala GM, Abdel-Raouf UM, Hamed MM. Antibacterial and anticancer activity of extracellular synthesized silver nanoparticles from marine Streptomyces rochei MHM13. Egypt J Aquat Res 2016; 42 (3): 301-312. https://doi.org/10.1016/j.ejar.2016.05.004.
    CrossRef
  38. Zhang XF, Liu ZG, Shen W, Gurunathan S. Silver Nanoparticles: Synthesis, Characterization, Properties, Applications, and Therapeutic Approaches. Int J Mol Sci 2016;17(9):1534. doi:10.3390/ijms17091534 .
    CrossRef
  39. Dakal TC, Kumar A, Majumdar RS, Yadav V. Mechanistic Basis of Antimicrobial Actions of Silver Nanoparticles. Front Microbiol 2016; 7: 1831. Doi:10.3389/fmicb.2016.01831
    CrossRef 
  40. Butler KS, Peeler DJ, Casey BJ, Dair BJ, Elespuru RK. Silver nanoparticles: correlating nanoparticle size and cellular uptake with genotoxicity. Mutagenesis. 2015; 30(4): 577-591. doi:10.1093/mutage/gev020
    CrossRef
  41. Mammari N, Lamouroux E, Boudier A, Duval RE. Current knowledge on the oxidative-stress-mediated antimicrobial properties of metal-based nanoparticles. Microorganisms 2022;10(2):437. http://dx.doi.org/10.3390/microorganisms10020437
    CrossRef
  42. Beyth N, Houri-Haddad Y, Domb A, Khan W, Hazan R. Alternative Antimicrobial Approach: Nano-Antimicrobial Materials. Evid Based Complementary Altern Med 2015;2015:1-16. doi:10.1155/2015/246012
    CrossRef
  43. Remya RR, Julius A, Suman TY, Aranganathan L, Dhas TS, Mohanavel V, et al. Biofabrication of silver nanoparticles and current research of its environmental applications. J Nanomater 2022;2022:1–11. http://dx.doi.org/10.1155/2022/2670429
    CrossRef
Visited 694 times, 1 visit(s) today
Article Metrics
PlumX PlumX: 
Views Views:  309 Views
PDF Downloads PDF Downloads:  1259

Article Publishing History
Received on: 28-11-2022
Accepted on: 28-03-2023

Article Review Details
Reviewed by: Dr. Tayebe Bagheri Lotfabad
Second Review by: Dr. Keshavamurthy M, Dr Shreeram Joglekar
Final Approval by: Dr. Chateen Izaddin Ali Pambuk


Share

FOLLOW US ON:

facebook Twitter Mendeley LinkedIn


SEARCH WEBSITE


MEMBER OF

Logo-image


JOURNAL ARCHIVED IN

Logo-image


Visited 694 times, 1 visit(s) today